Rnazol b

RNA was extracted from cells using RNAzol B (Tel-Test, Inc., Friendswood, Tex.), and was then converted to cDNA by reverse transcription. Samples were stored at -70°C until ready for analysis by PCR.

Brain tissues from the ipsilateral SN were dissected at the indicated time points after LPS or PBS injection with capsaicin or vehicle, and total RNA was extracted in a single step using RNAzol B (Tel-Test, Friendswood, TX) following the instructions of the manufacturer. Total RNA was reverse transcribed into cDNA using AMV reverse transcriptase (Promega, Madison, WI) and random primers (Promega). The primer sequences used in this study were as follows: 5′-TGATGTTCCCATTAGACAGC-3′ (forward) and 5′-GAGGTGCTGATGTAC CAG TT-3′ (reverse) for IL-1β (378 bp); 5′-ACACTCTATCACTGG CATCC-3′ (forward) and 5′-AAGGGACACCCTTTCACAT-3′ (reverse) for COX-2; 5′-GCAGAA TGTGACCATCATGG-3′ (forward) and 5′-ACAACCTTGGTGTTGAAGGC-3′ (reverse) for iNOS (557 bp); and 5′-TCCCTCAAGATTGTCAGCAA-3′ (forward) and 5′-AGATCCACAACGGATACATT-3′ (reverse) for glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 308 bp). The PCR amplification consisted of 30 cycles of denaturation at 94 °C for 30 s, annealing at 50 °C for 30 s (for IL-1β and GAPDH or 54 °C for 30 s for iNOS) and extension at 72 °C for 90 s. PCR products were separated by electrophoresis on 1.5% agarose gels, after which the gels were stained with ethidium bromide and photographed. For semiquantitative analyses, the photographs were scanned using a Computer Imaging Device and the accompanying software (Fujifilm, Tokyo, Japan).

Primary lung fibroblasts were plated onto 12-well plates (4 × 10⁴ cells/well) and incubated in DMEM (10% FBS) for 24 h. Fibroblasts were transfected with α7 nAChR or control non-target siRNA (150 ng) according to the manufacturer’s protocol using HiPerFect Transfection Reagent (Qiagen). Transfected fibroblasts were treated with 50 μg/ml nicotine for up to 72 h. RNA was extracted from cells or lung tissue using the reagent RNAzol B™ (Tel-test Inc., Friendswood, TX). Real-time PCR was performed as previously described [17 (link)] utilizing the primers to mouse collagen type I, 18S, IL-1β, and α7 nAChR in a SmartCycler™ system (Cepheid Sunnyvale, CA). Primer sequences are as follows: Mouse collagen type I forward (5’-GTGCTGTTGGTGCTGCTG), reverse (5’-CAGGAGCACCAGCAATAC); 18S forward (5’-GTGACCAGAGCGAAAGCA), reverse (5’-ACCCACGGAATCGAGAAA); IL-1β forward (5’-GAGCACCTTCTTTTCC), reverse (5’-CTGGTGGAAGAAAAGG), probe; and α7 nAChR forward (5’-CTGCTGGGAAATCCTAGGCACACTTGAG or GACAAGACCGGCTTCCATCC), reverse (5’-CCTGGTCCTGCTGTGTTAAACTGCTTC). Negative controls consisted of dH₂O and RNA without primers. Bioluminescent RT-PCR was accomplished according to a published method [18 (link)]. Values were normalized to 18S and expressed as relative change vs. untreated mouse lung tissue.