Total RNA was extracted from 3T3-L1 cells and mouse fat tissue using an RNeasy mini kit (Qiagen, Hilden, Germany) and TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. First-strand complementary DNA was synthesized from 0.5 μg of extracted total RNA using ReverTra Ace Master Mix (TOYOBO, Osaka, Japan). The RT-PCR was performed in a mixture containing Power SYBR Premix ExTaq (RP041A; Takara, Shiga, Japan), primers, and cDNA using a Thermal Cycler Dice instrument (Takara). Gene expression was normalized by housekeeping gene 36B4. The sequences of primers used are described by Song et al. [19 (link)]. Primers are specified in Supplementary Table S1 .
Thermal cycler dice instrument
Manufactured by Takara Bio
Sourced in Japan, China
The Thermal Cycler Dice instrument is a laboratory device used for controlled temperature cycling, which is a crucial step in various molecular biology techniques such as PCR (Polymerase Chain Reaction). The instrument provides precise temperature regulation and cycling capabilities to facilitate the amplification of DNA or RNA samples.
Automatically generated - may contain errors
Lab products found in correlation
One step sybr primescript plus rt pcr kit, by Takara Bio (5 mentions)
Trizol method, by Thermo Fisher Scientific (5 mentions)
Revertra ace master mix, by Toyobo (1 mentions)
Power sybr premix extaq, by Takara Bio (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Control methylated dna, by Qiagen (1 mentions)
Unmethylated dna, by Qiagen (1 mentions)
Epitech bisulfite kit, by Qiagen (1 mentions)
Sybr green real time pcr master mix plus, by Toyobo (1 mentions)
Thunderbird sybr qpcr mix, by Toyobo (1 mentions)
8 protocols using thermal cycler dice instrument
1
Quantitative RNA Expression Analysis
2
RNA Extraction and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the Trizol method (Invitrogen, NY, USA). A total of 5 μg of RNA were reverse-transcribed and amplified using One Step SYBR PrimeScript PLUS RT-PCR Kit (TaKaRa, Dalian, China) and the Thermal Cycler Dice instrument (TaKaRa, Dalian, China) according to the manufacturer’s instructions. RT-PCR primers are listed in Table S1 . Results were normalized to GAPDH.
3
Gene Expression and Epigenetic Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the Trizol method (Invitrogen). A total of 5 μg of RNA were reverse transcribed and amplified using One Step SYBR Prime-Script PLUS RT-PCR Kit (TaKaRa) and the Thermal Cycler Dice instrument (TaKaRa) according to the manufacturer’s instructions. The primer sequences used in this study are provided in the supplementary tables. For ChIP-qPCR, ChIP was performed as above mentioned, FOXA1 binding DNA was subsequently de–cross-linked and enriched for qPCR. qPCR amplification was performed using primers specific for the indicated gene promoters. The fold enrichment of binding relative to the input was calculated. IgG and random primers that could not specifically bind the indicated gene promoter regions (off target) were used as negative controls.
For methylation-specific qPCR, the extracted DNA was treated with sodium bisulfate to covert unmethylated cytosines to uracils using the EpiTech Bisulfite Kit (Qiagen, #59104). Methylation status of EPB41L3 and COL9A2 promoter regions was analyzed through a SYBR Green–based methylation-specific qPCR (57 (link)). Control methylated DNA and unmethylated DNA were purchased from Qiagen. After PCR amplification, a statistic analysis was performed to evaluate the quality of PCR product. All the primers used for this study are listed in table S10.
For methylation-specific qPCR, the extracted DNA was treated with sodium bisulfate to covert unmethylated cytosines to uracils using the EpiTech Bisulfite Kit (Qiagen, #59104). Methylation status of EPB41L3 and COL9A2 promoter regions was analyzed through a SYBR Green–based methylation-specific qPCR (57 (link)). Control methylated DNA and unmethylated DNA were purchased from Qiagen. After PCR amplification, a statistic analysis was performed to evaluate the quality of PCR product. All the primers used for this study are listed in table S10.
4
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The oTR-treated HL-60 cells were collected and washed with PBS buffer, and the total RNA was extracted with TRIzol according to the reagent instructions and quantified by NanoDrop. According to the manufacturer’s instructions, the genomic DNA was removed by adding gDNA Eraser Buffer, gDNA Eraser, total RNA, and RNase-free dH2O using the PrimeScriptRT kit. Then the above DNA-removing reaction solution, which was mixed with RNase-free dH2O, PrimeScript Buffer, RT Prime Mix, and PrimeScript RT Enzyme Mix, was reverse-transcribed using a Thermal Cycler Dice instrument (TaKaRa, Japan). The polymerase chain reaction (PCR) mixture consisted of TB Green Premix Ex Taq II (Tli RNaseH Plus), PCR primer, DNA template, and sterilized ddH2O according to the kit (TaKaRa, No. RR820A). The cycle threshold (CT) value of each gene mRNA was detected by real-time PCR using the LightCycler 96 and analyzed by 2-ΔΔCT method. The PCR primer sequences are given in Table 1 .
5
Quantifying Subunit Enrichment via RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the Trizol method (Invitrogen). A total of 5 μg of RNA were reverse transcribed and amplified using One-Step SYBR Prime-Script PLUS RT-PCR Kit (TaKaRa) and the Thermal Cycler Dice instrument (TaKaRa) according to the manufacturer’s instructions. The primers used in this study are listed in Supplementary Data 16 . The relative enrichment of the different subunits at each site was calculated using the 2-ΔΔCt method. Experiments were performed in triplicate and repeated at least twice.
6
SYBR Green-based Real-time qPCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time qPCR was performed with the SYBR Green Real-time PCR Master Mix-Plus (Toyobo) and the THUNDERBIRD® SYBR qPCR Mix (Toyobo) using a Thermal Cycler Dice instrument (TP800; Takara Bio) as described previously (17 (link), 18 (link)). Gene-specific primers were designed based on identified gene sequences and are listed in Supplementary Table S1 . Elongation factor 1α (EF1α) was used as a housekeeping gene and normalization control.
7
Quantitative RT-PCR Analysis of GFAT and GAPDH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the Trizol method (Invitrogen). A total of 5 μg of RNA were reverse-transcribed and amplified using One Step SYBR PrimeScript PLUS RT-PCR Kit (TaKaRa, Dalian, China) and the Thermal Cycler Dice instrument (TaKaRa) according to the manufacturer’s instructions. RT-PCR primers for GADPH and GFAT are listed as follows: GADPH sense: 5′- TGGTGAAGCAGGCATCTGAG-3′, antisense: 5′- CTCCTGCGACTTCAACAGCA-3′; GFAT sense: 5′- AACTACCATGTTCCTCGAACGA-3′, antisense: 5′- CTCCATCAAATCCCACACCAG-3′. Results were normalized to GAPDH.
8
Quantitative RT-PCR Analysis of c-Fos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the Trizol method (Invitrogen). A total of 5 μg of RNA were reverse transcribed and amplified using One Step SYBR Prime-Script PLUS RT-PCR Kit (TaKaRa) and the Thermal Cycler Dice instrument (TaKaRa) according to the manufacturer's instructions. The primers of c-Fos are sense-5'CTCAAGTCCTTACCTCTTCCG3'; antisense-5'GAGAAAAGAGACACAG ACCCAG 3'.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!