Moloney murine leukemia virus reverse transcriptase cdna synthesis kit

Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions, and 2 μg was reverse transcribed using 1 μl of oligo(dT)₁₈ primer, 25 units of RNase inhibitor, 2 μl of dNTPs (10 mM) and a Moloney Murine Leukemia Virus reverse transcriptase cDNA synthesis kit (Promega, Madison, WI, USA). Quantitative real-time PCR was performed with an iQTM SYBR Green Supermix PCR kit with an iCycler system (Bio-Rad, Hercules, CA, USA) under conditions of 95°C for 10 min., followed by 40 cycles at 95°C for 15 sec. and 60°C for 60 sec. The primers used are shown in Table1. GAPDH was amplified as an internal control. The RT-PCR data were quantified using the 2^−ΔΔCt method.

RNA was isolated from the cells using Trizol (Invitrogen) according to the manufacturer’s instructions. cDNA was generated from total denatured RNA (2 µg) by using 1 µl oligo(dT)₁₈ primer, 25 units RNase inhibitor, 2 µl dNTPs (10 mM), and a Moloney Murine Leukemia Virus reverse transcriptase cDNA synthesis kit (Promega, Madison, WI, USA). Quantitative real-time PCR was performed using Applied Biosystems 7500 Real-Time PCR System and SYBR® Premix Ex Taq™ kit (Perfect Real Time) (TaKaRa, Dalian, China). Human 18s rRNA was used as internal control. The Cycle threshold (CT) values for each gene were corrected using the mean CT value. Real-time PCR data were quantified using the ΔCT method with the formula: n = 100 × 2^{−(ΔCT targeted gene − ΔCT 18s rRNA)}. Targeted genes were amplified by real time PCR with the following primers: 18s rRNA forward: 5′GACTCAACACGGGAAACCTCAC3′ and reverse: 5′CCAGACAAATCGCTCCACCAAC3′; Human BCRP, forward 5′GCAGCAGGTCAGAGTGTGGTTT3′, reverse 5′GCTGCAAAGCCGTAAATCCATA3′; Human MRP1 forward: 5′CGCTGAGTTCCTGCGTACCTAT′ and reverse: 5′CCATTCTCCATTTGCTTTGCTT3′, Human MDR1 forward: 5′CCGTGGGGCAAGTCAGTTCAT3′ and reverse: 5′CCTTCCAATGTGTTCGGCATTAG3′.