Quant studio 7 flex

Manufactured by Bio-Rad

The Quant Studio 7 Flex is a real-time PCR system designed for high-throughput nucleic acid analysis. It features 96-well block format and supports a variety of sample types and applications, including gene expression, genetic variation, and pathogen detection. The system provides precise temperature control and optical detection capabilities to enable reliable and reproducible results.

Automatically generated - may contain errors

Lab products found in correlation

Quantstudio 7 flex instrument, by Thermo Fisher Scientific (1 mentions) Mirvana isolation kit, by Thermo Fisher Scientific (1 mentions) Itaq sybr green supermix, by Bio-Rad (1 mentions) Quantitect reverse transcription kit, by Qiagen (1 mentions) Sybr green supermix, by Bio-Rad (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions)

2 protocols using quant studio 7 flex

Gene Expression Analysis via RT-qPCR and TaqMan Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with a miRVana isolation kit (Thermo Fisher) and reverse-transcribed to cDNA with a QuantiTect reverse transcription kit (Qiagen) according to the manufacturer’s instructions. cDNA samples synthesized from 1 μg of total RNA were subjected to RT-qPCR with the Applied Biosystems Quant Studio 7 Flex instrument using the iTaq SYBR Green Supermix (Bio-Rad). Relative gene expression was calculated using the ΔΔCT method normalizing the expression to that of a stable reference gene (GAPDH or as stated). We assumed a primer efficiency of 100% (±10%), according to manufacturer’s guidelines. The primers are listed in Table S3.
TaqMan gene expression assays (Fig. 4) were conducted using probes from ThermoFisher listed in Table S4. They were used following manufacturer’s protocols and run on an Applied Biosystems Quant Studio 7 Flex instrument. Data were analyzed as described above.

Cheng J., Tsuda M., Okolotowicz K., Dwyer M., Bushway P.J., Colas A.R., Lancman J.J., Schade D., Perea-Gil I., Bruyneel A.A., Lee J., Vadgama N., Quach J., McKeithan W.L., Biechele T.L., Wu J.C., Moon R.T., Si Dong P.D., Karakikes I., Cashman J.R, & Mercola M. (2021). Small Molecule Probe Reveals a Kinase Cascade that Links Stress Signaling to TCF/LEF and Wnt Responsiveness. Cell chemical biology, 28(5), 625-635.e5.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with TRIzol reagent (Invitrogen) following the manufacturer's instructions. Real‐time quantitative‐PCR was performed using QuantStudio 7 Flex and SYBR Green Supermix (Bio‐Rad). Real‐time PCR primers were designed by Primer Premier 5.0 and their sequences were as follows:

Human p21 forward, 5′‐AGTCAGTTCCTTGTGGAGCC‐3′,

Human p21 reverse, 5′‐CGCAGAAACACCTGTGAACG‐3′.

Mouse p21 forward, 5′‐AGGCATATCTAGGCACTTGC‐3′,

Mouse p21 reverse, 5′‐CCACACACCATAGAATGCTC‐3′.

SARS‐CoV‐2 N forward, 5′‐GAAATGCACCCCGCATTACG‐3′,

SARS‐CoV‐2 N reverse, 5′‐GTGAGAGCGGTGAACCAAGA‐3′.

Mouse Cyclin E forward, 5′‐GCAGGCGAGGATGAGAGCAGT‐3′,

Mouse Cyclin E reverse, 5′‐CCCGGAGCAAGCGCCATCTGTA‐3′.

Human GAPDH forward, 5′‐GAAGGTGAAGGTCGGAGTC‐3′,

Human GAPDH reverse, 5′‐GAAGATGGTGATGGGATTTC‐3′.

Mouse GAPDH forward, 5′‐GGTGAAGGTCGGTGTGAACG‐3′,

Mouse GAPDH reverse, 5′‐CTCGCTCCTGGAAGATGGTG‐3′.

Wang W., Chen J., Hu D., Pan P., Liang L., Wu W., Tang Y., Huang X.R., Yu X., Wu J, & Lan H.Y. (2021). SARS‐CoV‐2 N Protein Induces Acute Kidney Injury via Smad3‐Dependent G1 Cell Cycle Arrest Mechanism. Advanced Science, 9(3), 2103248.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!