Scramble shrna

The isolated MAECs were cultured for 5 days and then were respectively transfected with the three different lentivirus-packed rat shRNAs against Pellino-1 and scramble shRNA (GenePharma, Shanghai, China). The sequences of sh-RNAs are as follows: Peli1-a, 5′-CCT​GGA​ATA​TGG​AGA​GAG​ATA-3′; Peli1-b, 5′-GAC​GGC​AAA​GAT​CGT​GAA​TGT-3′; Peli1-c, 5′-ACC​AGC​ATA​GCA​TAT​CGT​ATA-3′; the sequence of scramble shRNAs is: 5′-TTCTCCGAACGTGTCACGT-3′.The knocking down efficiency of Pellino-1 were determined by western blots.

The CD47-shRNA and control sequences were obtained from Shanghai GenePharma Co., Ltd. The sequences are as follows: CD47-shRNA (5′-CGTCACAGGCAGGACCCACTGCCCA-3′), scramble-shRNA (5′-CGTGACAGCCACGACCGACTGCGCA-3′). The SK-OV-3 cells were transduced by lentiviruses. The shRNA-coding lentiviruses were packed and harvested according to the manufacturer's protocol. Lentiviral transduction was performed according to the manufacturer's instructions. Briefly, 50,000 SK-OV-3 cells were plated in a 24-well plate on day 1. On day 2, the cells were primed with 8 μg/mL of hexadimethrine bromide, and viral particles were added to the culture at a multiplicity of infection (MOI) of 5. After 12 h of transduction, the virus-containing medium was replaced with fresh medium. Puromycin (2 μg/mL) selection started on the following day, and the surviving colonies were expanded for experiments.

A shRNA sequence targeting the TLN-1 gene (GenBank. No. NM_006289.3) (5’-GCTCGAGATGGCAAGCTTAAA-3’) and one nonspecific sequence 5’-TTCTCCGAACGTGTCACGTTTC-3’ (scramble shRNA) used as the negative control which did not have any homology with the target gene were designed and packaged into Lentivirus and transduced into 293 T cells by Shanghai GenePharma Co., Ltd (China).
For TLN-1 silencing, 0.5 × 10⁵ MHCC-97 L cells were plated in 24-well plates in complete culture medium for 24 h. Then, cells were transduced for 72 h with Lentivirus-mediated TLN-1-shRNA and scramble shRNA, respectively (Shanghai GenePharma Co., Ltd, China), under puromycin selection. Afterwards, the transduced cells were cultured in DMEM containing 10 % FBS and 3 μg/ml of puromycin for 12 days (changing the medium every 3 days), and stably transduced cells were obtained. TLN-1 mRNA and protein levels were assessed by real-time RT-PCR and western blot.

To obtain the shCCAT2-expressing cells, the pGV248-CCAT2 shRNA and scramble shRNA obtained by Genepharma (Shanghai, China) were respectively transfected into 293T cells along with the packaging plasmids. The lentivirus partials were harvested and the knockdown efficiency was determined by qRT-PCR after co-transfection 48h. The lentivirus with pGV248-CASC2 shRNA or scramble shRNA was then used to infect glioma cells to construct stable expression cell lines for functional analysis.

Two short hairpin RNAs (shRNAs) specifically targeting the hTERT (shRNA1, GCATTGGAATCAGACAGCACT (sense), shRNA2, TGAGGCCTGAGTGAGTGTTTG (sense)), and a scramble shRNA (GACCTGTACGCCAACACAGTG (sense)) were synthesized by Genepharma (Shanghai, P. R. China). The hTERT shRNA and scramble shRNA sequences were each cloned into the pGCsilencer expressing plasmid (Genechem, Shanghai, P. R. China) and transiently transfected into CAPAN-2 and CAL-27 cells for 48 h using Lipofectamine 2000 reagent (Invitrogen, USA) following the manufacturer's instructions.

To knock down the expression of GPR91 in hPDLCs, cells were transfected for 24 h with GPR91 shRNA (25 nM; GenePharma, China) or scramble shRNA (25 nM; GenePharma, China) as a negative control with Envirus™ (Engreen Biosystem) according to the manufacturer's protocol. The culture medium was replaced with complete culture medium 24 h later. At least 72 h after transfection, cells were used for subsequent testing. The sequences of the shRNAs used in this study were as follows: control shRNA (shNC), 5′-GGAGTTATGCCAATGGAAACT-3′, and GPR91 gene shRNA, 5′-GGAGTTATGCCAATGGAAACT-3′.