Phusion flash high fidelity pcr master mix

The viral RNA was reverse transcribed by SuperScript Reverse Transcriptase (Life Technologies) according to the manufacturer’s protocol. PCR was performed using 1X Phusion™ Flash High-Fidelity PCR Master Mix (Thermo Scientific) using FU2 (5′_9233 GCTGATGACACCGCCGGCTGGGACAC 9259_3′) and CFD3 (5′_10077AGCATGTCTTCCGTGGTCATCCA10100_3′) primers that flank 844 bp at the N-terminal of the NS5 gene.^{42 (link)} The amplicons were purified by the QIAgen PCR purification kit according to the manufacturer’s protocol and subjected to sequencing at a commercial sequencing facility using the BigDye terminator Cycle Sequencing Kit (Applied Biosystems, Foster city, CA). Phylogenetic analysis of the NS5 gene was performed using the neighbor-joining method as described earlier.

The total bacterial DNA was extracted with the Sambrook and Russell method (2001 , with own modification). The universal 16S rDNA primers 27F (5′-AGAGTTTGATCATGGCTCAG-3 ′) and 1492 R (5′-TACGGTTACCTTGTTACGACTT-3′) were synthesized to amplify the 16S rRNA gene of the isolates obtained, using its genomic DNA as a template. For the PCR reaction (50 μl), 1X Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific) was used. The reaction conditions consisted in initial denaturation at 98 °C for 10 s, 30 cycles of 98 °C for 5 s, primer annealing at 53 °C for 5 s, and elongation at 72 °C for 40 s. Afterwards, the PCR amplification products were separated by electrophoresis in a 1 % agarose gel. Then, all products were gel purified and sequenced. The 16S rDNA fragments of all isolates obtained were sent to the Genomed S.A. (Warsaw) for sequencing. The results obtained were analyzed by BLAST online comparison (http:// www.ncbi.nlm.nih.gov) for identification of the isolates.

PCR amplification targeting the 900 bp variable region of the p67 encoding gene was performed on 232 T. parva positive DNA samples (Table 1), using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) [22 (link)] and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity [37 (link)]. At least 50 ng of DNA and 10 pmol of each primer were used in a total reaction volume of 12.5 μl. The amplification conditions were as previously described [22 (link)], with some modifications in accordance with the Phusion Flash High-Fidelity PCR Master Mix conditions. Thus, the initial denaturation was done at 98°C for 10 seconds (s), followed by 30 cycles of denaturation at 98°C for 1 s, annealing at 57°C for 5 s and extension at 72°C for 10 s, then one cycle for the final extension step at 72°C for 1 minute (min). Samples that failed to amplify in the primary reaction were re-amplified in the second PCR using 0.5 μl of the primary PCR product as DNA template, and the same amplification conditions except that the amplification cycles were reduced to 20. PCR products were resolved by gel electrophoresis using 2% agarose stained with ethidium bromide.

Genomic DNA was extracted from cells using an ammonium acetate-based method as described previously [27 (link)]. To control for representation, PCR with gRNAs sequence primer listed in Additional file 6: Table S1b was performed on genomic DNA equivalent to 500 cells per guide, corresponding to a total of 231 μg from 35 million cells (assuming 6.6 pg in a single diploid cell). This input DNA was split into 77 reactions with 3 μg per reaction. For the verification of amplified SAM gRNA library, 10 ng of input plasmid DNA was used. PCR was conducted using Phusion Flash High-Fidelity PCR master mix (Life Technologies) for 28 cycles as 98 °C for 90 s, 98 °C for 1 s, 60 °C for 5 s, 72 °C for 15 s, followed by final extension of 72 °C for 1 min. To enable multiplexing during NGS, an 8 bp unique barcode was added at the beginning of the forward primer as TCGCCTTG, ATAGCGTC, GAAGAAGT, ATTCTAGG or CGTTACCA. All PCR products were pooled, ethanol precipitated and resuspended in 100 ul. This was subjected to electrophoresis on a 2% agarose gel and the band of interest was extracted using Monarch DNA Gel extraction kit (NEB GmbH, Frankfurt, Germany) according to manufacturer’s instructions. NGS libraries were prepared from amplicons by GATC Biotech (Konstanz, Germany) and 125 bp paired end sequencing was carried out on an Illumina HiSeq 4000 with 15 million reads per condition.