Plenti cmv hygro dest

Manufactured by Addgene

The PLenti CMV Hygro DEST is a lentiviral vector that can be used for expression or knockdown of target genes in mammalian cells. It contains a Hygromycin resistance cassette for selection of transduced cells.

Automatically generated - may contain errors

Lab products found in correlation

6 protocols using plenti cmv hygro dest

Establishing Stable Cell Lines for Molecular Studies

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

CTRL and SGEF KD MDCK cell lines were established in our previous publication (Awadia et al., 2019 (link)). Constructs to KD Slug in SGEF KD were cloned into pLKO.1-Hygro (Addgene 24150). To generate Scribble and Dlg1 CRISPR/Cas9 KO cell lines we used pLentiCRISPR v2-Blast (Addgene 83480). DH-PH and VSV-G-DH-PH Rescue constructs were cloned using gateway recombination (Thermo Fisher) into pLenti CMV Hygro DEST (Addgene 17454). We generated stable cells lines using these constructs via lentiviral delivery and antibiotic selection. For KO cell lines single cell clones were identified and validated. Details for the constructs used in this study, including shRNA and gRNA targeting sequences utilized are listed in Supp. Table 1

Rabino A., Awadia S., Ali N., Edson A, & Garcia-Mata R. (2024). The Scribble/SGEF/Dlg1 complex regulates the stability of apical junctions in epithelial cells. bioRxiv.

+ Open protocol

+ Expand

Cloning and Modification of JAZF1, MBTD1, and CATACOMB

Check if the same lab product or an alternative is used in the 5 most similar protocols

JAZF1, JAZF1-SUZ12, and MBTD1 cDNA used in this study were cloned as gBlocks (IDT) using Gibson Assembly (E5510, New England BioLabs) into kanamycin-resistant pUC57 containing AttL sites for Gateway recombination. All the reactions were performed according to the manufacturer’s instructions. We used EF1α HA-FLAG PURO DEST (gift from D. Pasini) and pLenti CMV Hygro DEST (a gift from E. Campeau and P. Kaufman; #17454, Addgene) destination vectors. CATACOMB cDNA was generated as a polymerase chain reaction (PCR) product from pCMV SPORT6 CATACOMB (MHS6278-202759346, Dharmacon) and cloned into kanamycin-resistant pUC57 by Gibson Assembly. All mutations reported in this study were generated by PCR in the pUC57 CATACOMB plasmid. CATACOMB cDNA was then shuffled into destination vectors by Gateway recombination. The MBTD1-CATACOMB fusion gene was generated by digesting pUC57 CATACOMB plasmid with BmgBI restriction enzyme and inserting a MBTD1 cDNA gBlock (IDT) lacking the last 139 nucleotides by Gibson Assembly. We then removed unnecessary DNA sequences by PCR and obtained a MBTD1-CATACOMB cDNA as identified in two ESS samples (8 (link)). The resulting cDNA was shuffled in EF1α HA-FLAG PURO DEST by Gibson Assembly. All the vectors used in this study were Sanger sequence verified.

Piunti A., Smith E.R., Morgan M.A., Ugarenko M., Khaltyan N., Helmin K.A., Ryan C.A., Murray D.C., Rickels R.A., Yilmaz B.D., Rendleman E.J., Savas J.N., Singer B.D., Bulun S.E, & Shilatifard A. (2019). CATACOMB: An endogenous inducible gene that antagonizes H3K27 methylation activity of Polycomb repressive complex 2 via an H3K27M-like mechanism. Science Advances, 5(7), eaax2887.

+ Open protocol

+ Expand

Lentivirus Production for SARS-CoV-2 Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following cDNA sequence containing plasmids were obtained: hACE2 (Addgene, #1786, gift from Hyeryun Choe), TMPRSS2 (Addgene, #53887, gift from Roger Reeves), TMEM106B (Genscript, OHu17671) and VAC14 (Addgene, #47418, gift from Peter McPherson).
Individual cDNAs were cloned into EcoRV-cut plenti-CMV-Puro-DEST Addgene, #17452, gift from Eric Campeau & Paul Kaufman) or plenti-CMV-Hygro-DEST (Addgene, #17454, gift from Eric Campeau & Paul Kaufman) using NEBuilder HiFi DNA Assembly Master Mix (NEB). To generate the plenti-CMV-ACE2-IRES-TMPRSS2 construct, ACE2, EMCV IRES (derived from pLenti-DsRed_IRES_EGFP (Addgene, #92194, gift from Huda Zoghbi)), and TMPRSS2 were individually amplified with addition of overlapping sequences and the three fragments were assembled using NEBuilder HiFi DNA Assembly Master Mix.
Lentivirus was produced in HEK293FT by co-transfection of cDNA containing lentiviral plasmid together with pCMV-dR8.2 dvpr (Addgene, #8455, gift from Bob Weinberg), pCMV-VSV-G (Addgene, #8454, gift from Bob Weinberg) and pAdVAntage (Promega) using FugeneHD (Promega). Supernatants were collected 48h post-transfection, filtered and added to recipient cells in presence of Polybrene (SCBT). Transduced cells were subsequently selected using Puromycin or Hygromycin for 5–7 days.

Wang R., Simoneau C.R., Kulsuptrakul J., Bouhaddou M., Travisano K., Hayashi J.M., Carlson-Stevermer J., Oki J., Holden K., Krogan N.J., Ott M, & Puschnik A.S. (2020). Functional genomic screens identify human host factors for SARS-CoV-2 and common cold coronaviruses. bioRxiv.

+ Open protocol

+ Expand

Genetic Manipulation of PCDH7 and KRAS

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human PCDH7 isoform-A (NM_002589.2) cDNA was cloned into the CTV vector (Addgene #15912). The resulting CTV-PCDH7 was used to generate transgenic mice. Depletion of PCDH7 in vitro was performed by using Lenti-CRISPR-V2 (Addgene #52961) to introduce Cas9 and sgRNA directed against Pcdh7. Depletion of mouse Pcdh7 in vivo was performed using pSECC (Addgene #60820). The sgRNAs are as follows: human PCDH7, CGACGTCCGCATCGGCAACG; Mouse Pcdh7, GAGGATGCGGACCACGGGAT; human non-specific control, CGCTTCCGCGGCCCGTTCAA; mouse non-specific control, GCGAGGTATTCGGCTCCGCG. Human Kras^G12V cDNA was cloned into pLenti CMV Hygro DEST (Addgene #17454) for ectopic expression of Kras^G12V in HBECs. The human PCDH7 isoform-A cDNA was cloned into pLX303 lentivirus vector (Addgene #25897) for PCDH7 overexpression in vitro.

Zhou X., Padanad M.S., Evers B.M., Smith B., Novaresi N., Suresh S., Richardson J.A., Stein E., Zhu J., Hammer R.E, & O’Donnell K.A. (2018). Modulation of mutant KrasG12D-driven lung tumorigenesis in vivo by gain or loss of PCDH7 function. Molecular cancer research : MCR, 17(2), 594-603.

+ Open protocol

+ Expand

Lentiviral Transduction and Inhibitor Screening

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The plasmids used in the present study were pLenti CMV-BRAF V600E and pLenti-CMV-GNA11 Q209L, which subcloned human BRAF^V600E or GNA11^Q209L cDNA into pLenti CMV Hygro DEST (a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17454)^{37 (link)}. LentiCas9-Blast was a gift from Feng Zhang (Addgene plasmid #52962; http://n2t.net/addgene:52962; RRID:Addgene_52962)^{38 (link)}. Lentivirus particles were produced as previously described^{39 (link)}.
The Arp2/3 inhibitor, CK-689, and the PI3K inhibitor, LY294002, were purchased from Merck KGaA (Darmstadt, Germany). The AKT inhibitor, MK-2206, was obtained from Active Biochemicals (Wan Chai, Hong Kong). The RSK inhibitors, BI-D1870 and LJH685, were supplied by BioVision (BioVision, Milpitas, CA, USA) and Cayman Chemical (Cayman Chemical, Ann Arbor, MI, USA), respectively. ALW II-41-27 was purchased from MedChemExpress (Monmouth Junction, NJ, USA).

Yasuta Y., Kaminaka R., Nagai S., Mouri S., Ishida K., Tanaka A., Zhou Y., Sakurai H, & Yokoyama S. (2024). Cooperative function of oncogenic MAPK signaling and the loss of Pten for melanoma migration through the formation of lamellipodia. Scientific Reports, 14, 1525.

+ Open protocol

+ Expand

Cloning and Mutagenesis of HAPSTR2

Check if the same lab product or an alternative is used in the 5 most similar protocols

The human coding sequence for HAPSTR2 (Ensembl) was synthesized (Twist Biosciences) with flanking attB fragments for Gateway BP cloning. From this template, HAPSTR2-G116R was cloned by overlap extension PCR. Mutagenic primers were designed (see Supplementary Table 1) to first amplify the region up- and downstream of the mutation. These products were gel purified (Qiagen) and then used as a template for a second PCR, which comprised 15 cycles without primers and then 30 cycles with primers flanking the start and stop codon. The ΔNLS (1-249) HAPSTR2 mutant was also cloned from this template using attB-flanked primers to achieve an amplicon comprising residues 1-253 and introducing a stop codon (see Supplementary Table 1). HAPSTR2 constructs were then cloned into the Gateway donor vector pDONR221, and from there into expression vectors: pDest-HisMBP (Addgene 11085), pLenti6.2 3XFLAG-V5-ccdB (Addgene 87072), or pLenti CMV Hygro DEST (Addgene 17454). All PCRs used the 2x CloneAmp HiFi polymerase premix (Takara) and followed the manufacturer’s protocol for cycle number and length. All plasmids were verified through Sanger sequencing.

Amici D.R., Cingoz H., Alasady M.J., Alhayek S., Phoumyvong C.M., Sahni N., Yi S.S, & Mendillo M.L. (2023). The HAPSTR2 retrogene buffers stress signaling and resilience in mammals. Nature Communications, 14, 152.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!