Steponeplus real time pcr

Tumors, cells and gWAT qPCRs were performed in 25 μL with 0.05–1 μL RT product, 1 U Taq DNA polymerase (Pegasus), 4 mm MgCl₂, 0.2 mm dNTPs, 3 × 10⁻⁵ μL SYBR Green (Sigma‐Aldrich), 0.1 μm forward primer, and 0.1 μm reverse primer. The reactions were incubated in StepOne Plus Real Time PCR (Applied Biosystems, Beverly, MA, USA) (94 °C 2 min, 40 cycles: 95 °C 15 s, annealing temperature 20 s, 72 °C 25 s and 95 °C 15 s). Plasma and media qPCRs were run in 10 μL with 0.1 μm of each primer and 5 μL of PowerUp™ SYBR™ Green Master Mix (Thermo Fisher, Beverly, MA, USA), in StepOne Plus Real Time PCR (Applied Biosystems, Beverly, MA, USA) (50 °C 2min, 95 °C 10 min, 40 cycles: 95 °C 15 s, annealing temperature 15 s, 60 °C 1 min, and 95 °C 15 s). The expression levels of miRNAs were calculated using ΔΔC_T method normalizing to geometric mean of mmu‐miR‐103a‐3p and 191‐5p and control (for tumor, cells, and gWAT). The expression levels of plasma were normalized to cel‐miR‐39 (a synthetic spike in added to the sample prior to RNA extraction). For culture media, we used mmu‐miR‐19b as a normalizer since it was detected with high signal in the microarray analyses and showed no changes between the experimental groups. Primer sequences are listed in Table S1.

The phenol–chloroform extraction described by Barker et al. [35 ] was used to extract the Genomic DNA, which was collected, in turn, via saliva swab. To prepare the gDNA for the genotyping, a two allele-specific fluorescent probe including a PCR primer pair (TaqMan SNP Genotyping Assays, Life Technologies, CA, USA) and a master mix including dNTPs and Taq DNA Polymerase (TaqPath ProAmp Master mix Life Technologies, CA, USA) were used. The FTO rs9939609 context sequence was the following: GGTTCCTTGCGACTGCTGTGAATTT [A/T] GTGATGCACTTGGATAGTCTCTGTT. Finally, SNP genotyping assessment was executed using a Real-Time PCR analysis (Applied Biosystems StepOnePLus Real-Time PCR, Life Technologies, CA, USA), according to the manufacturer’s instructions.