Tumors, cells and gWAT qPCRs were performed in 25 μL with 0.05–1 μL RT product, 1 U Taq DNA polymerase (Pegasus), 4 mm MgCl2, 0.2 mm dNTPs, 3 × 10−5 μL SYBR Green (Sigma‐Aldrich), 0.1 μm forward primer, and 0.1 μm reverse primer. The reactions were incubated in StepOne Plus Real Time PCR (Applied Biosystems, Beverly, MA, USA) (94 °C 2 min, 40 cycles: 95 °C 15 s, annealing temperature 20 s, 72 °C 25 s and 95 °C 15 s). Plasma and media qPCRs were run in 10 μL with 0.1 μm of each primer and 5 μL of PowerUp™ SYBR™ Green Master Mix (Thermo Fisher, Beverly, MA, USA), in StepOne Plus Real Time PCR (Applied Biosystems, Beverly, MA, USA) (50 °C 2min, 95 °C 10 min, 40 cycles: 95 °C 15 s, annealing temperature 15 s, 60 °C 1 min, and 95 °C 15 s). The expression levels of miRNAs were calculated using ΔΔCT method normalizing to geometric mean of mmu‐miR‐103a‐3p and 191‐5p and control (for tumor, cells, and gWAT). The expression levels of plasma were normalized to cel‐miR‐39 (a synthetic spike in added to the sample prior to RNA extraction). For culture media, we used mmu‐miR‐19b as a normalizer since it was detected with high signal in the microarray analyses and showed no changes between the experimental groups. Primer sequences are listed in Table S1 .
Steponeplus real time pcr
Manufactured by Thermo Fisher Scientific
Sourced in United States, Japan, United Kingdom, Italy, Germany
The StepOnePlus Real-Time PCR system is a compact, easy-to-use instrument designed for quantitative real-time PCR analysis. It features a high-resolution optical system, precise temperature control, and intuitive software for data analysis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (25 mentions)
Rneasy mini kit, by Qiagen (20 mentions)
Trizol, by Thermo Fisher Scientific (17 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (15 mentions)
M mlv reverse transcriptase, by Promega (8 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (6 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (5 mentions)
Iscript cdna synthesis kit, by Bio-Rad (5 mentions)
Taqman gene expression master mix, by Thermo Fisher Scientific (5 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (5 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (5 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (5 mentions)
Sybr premix ex taqtm, by Takara Bio (4 mentions)
High capacity cdna kit, by Thermo Fisher Scientific (4 mentions)
Nanodrop, by Thermo Fisher Scientific (4 mentions)
Sybr premix ex taq, by Takara Bio (4 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (4 mentions)
Sybr green, by Merck Group (3 mentions)
Rnaqueous 4pcr kit, by Thermo Fisher Scientific (3 mentions)
Taqman snp genotyping assay, by Thermo Fisher Scientific (3 mentions)
177 protocols using steponeplus real time pcr
1
Quantitative PCR Protocol for miRNA Expression
2
Quantify Cancer-Related Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the mRNA level of Bax, Bcl-2, CCDN1, Rb, Caspase-3 and Caspase-8, RT-PCR analysis was used. Total RNA was isolated with E.Z.N.A. Total RNA Kit (Omega Bio-Tek, Norcross, GA) according to the manufacturer instructions. Then isolated RNA purity and concentrations were measured by Qubit 4 Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA). cDNA synthesis was performed with a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA). The changes in mRNA levels of selected genes were measured by The StepOnePlus Real- Time PCR (Applied Biosystems) using Universal Master mix II (Applied Biosystems, Foster City, CA). The commercial primer sets of Bax (Hs00180269_m1), Bcl-2 (Hs00236808_s1), CCDN1 (Hs00765553_m1), Rb (Hs01078066_m1), Caspase-3 (Hs00234387_m1), Caspase-8 (Hs01018151_m1) and β-Actin (Hs99999903_m1) (Applied Biosystems, Foster City, CA) were used for RT-PCR. β-Actin was accepted as an endogenous reference gene.
3
Curcumin Regulates TLR4 Expression in Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time polymerase chain reaction (RT-PCR) analysis was performed to analyze the mRNA levels of TLR4 in breast cancer cells treated with curcumin alone (5, 10 and 25 µM), LPS alone (2 µM) and the combination of curcumin plus LPS. Total RNA was isolated by using E.Z.N.A.® Total RNA Kit (Omega Bio-Tek, Norcross, GA). The purity and concentration of isolated RNAs were determined by Qubit 4 Fluorometer (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was then synthesized by using High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA). RT-PCR was performed by TaqMan™ Gene Expression Assay for determination of mRNA levels of TLR4 in The StepOnePlus™ Real-Time PCR (Applied Biosystems, Foster City, CA). β-actin was utilized as the endogenous reference gene. Each experiment was performed in three replicates.
4
Tissue-specific Gene Expression in Metabolic Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from hypothalamus, NAcc, peri-ovarian adipose tissue (100 mg) and liver (100 mg) were extracted using 1 mL Trizol Reagent (Invitrogen, Carlsbad, CA, USA) and synthesis of cDNA was performed, as previously described [30 (link)], with 400 µg total RNA. Real-time PCR was performed on a StepOnePlusTM real-time PCR (Applied Biosystems, Foster City, CA, USA) using SYBR green fast reagent PCR master mix (Applied Biosystems) under the following conditions: 10 min at 95 °C, 40 cycles of 95 °C for 15 s and 1 min at 60 °C. Primers sequences used are detailed in Supplementary Materials Table S1 . Gene expression was determined using the formula below. Results of this gene expression are presented as an arbitrary unit using the NPNP group as reference sample (NPNP gene expression = 1).
5
Analysis of Tumor Suppressor Genes in HepG2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
From HepG2 cells, total RNA was isolated using TRIzol reagent (Ambion). Further reverse transcription was carried out by using Fermentas cDNA kit. RT-PCR was performed with gene-specific primers for tumor suppressor genes (TSGs), viz. DPT, RUNX3, p16, RASSF1A and SOCS1 on Applied Biosystems StepOnePlusTM Real-Time PCR. 18 s rRNA was used as endogenous control. Relative quantification of gene expression was done by using the comparative CT method (ΔΔCT).
6
Quantification of Apoptosis-Related Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immediately after the experiments, cells were washed twice with cold PBS and harvested in Extracol. The concentrations of isolated RNA were determined using NanoDrop™ One (DeNovix, Wilmington, DE, USA). 1 µg of RNA was reverse transcribed using NG dART kit in thermal cycling condition: 65 °C for 60 min, 85 °C for 5 min, and finally cooling to 4 °C. The RT-PCR was performed using 20 ng of cDNA, specific primers and SG qPCR Master Mix in Applied BiosystemsTM StepOne PlusTM Real-Time PCR (Applied Biosystems, Foster City, CA, USA) with thermal condition: 1 cycle of 95 °C for 15 min, 40 cycles of 95 °C for 60 s, 40 cycles of 60 °C for 30 s, and 1 cycle of 72 °C for 30 s. Values of mRNA expression for Bax, Caspase-9, and NF-kB were normalized to gene reference-elongation factor-2 (EF2). The relative gene expression was quantified using ΔΔCT method as described previously [81 (link)]. RT-PCR measurements were conducted 3 times for statistical purposes
7
Colon Tissue RNA Extraction and RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the descending colon tissue using TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) as recommended by the manufacturer, and the collected RNA was purified using an RNeasy Mini kit (Qiagen). Complementary DNA synthesis was performed using 1 µg of total RNA with the High-Capacity cDNA kit (Applied Biosystems, Foster City, CA), according to the manufacturer’s instructions. RT-qPCR was performed in triplicate using a StepOnePlusTM Real-time PCR (Applied Biosystems, Waltham, MA, USA) with SYBR® Premix Ex TaqTM (TaKaRa Bio; Shiga, Japan) according to the manufacturer’s instructions with designed primer (Table S3 ). The expression level of mRNA for the target genes was compared with endogenous control β-actin using the 2−ΔΔCt method.
8
Gene Expression Analysis of Zebrafish Blood Cells
9
Genotyping of FTO rs9939609 Variant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The phenol–chloroform extraction described by Barker et al. [35 ] was used to extract the Genomic DNA, which was collected, in turn, via saliva swab. To prepare the gDNA for the genotyping, a two allele-specific fluorescent probe including a PCR primer pair (TaqMan SNP Genotyping Assays, Life Technologies, CA, USA) and a master mix including dNTPs and Taq DNA Polymerase (TaqPath ProAmp Master mix Life Technologies, CA, USA) were used. The FTO rs9939609 context sequence was the following: GGTTCCTTGCGACTGCTGTGAATTT [A/T] GTGATGCACTTGGATAGTCTCTGTT. Finally, SNP genotyping assessment was executed using a Real-Time PCR analysis (Applied Biosystems StepOnePLus Real-Time PCR, Life Technologies, CA, USA), according to the manufacturer’s instructions.
10
Quantitative miRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Detection of miRNAs was performed using the TaqMan® Small-RNA primer and probe sets (Applied Biosystems, Foster City, CA, USA, Thermo Fisher Scientific Inc.), as previously describe [96 (link)]. qRT-PCR was performed in duplicate by Step One Plus Real-Time PCR (Life Technologies, Thermo Fisher Scientific Inc.) under the following conditions: 95 °C for 20 s, followed by 40 cycles of 95 °C for 1 s, and 60 °C for 20 s. Each value of miRNA expression was represented relative to the expression of external synthetic cel-miR-39 (Applied Biosystems, Thermo Fisher Scientific Inc.), which was used as an internal control. The fold change was calculated using the ΔΔCt method (Applied Biosystems™ Analysis Software, Relative Quantification Analysis Module, v4.1, Applied Biosystems, Foster City, CA, USA, Thermo Fisher Scientific Inc.).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!