Cdna reverse transcriptase kit

Manufactured by Thermo Fisher Scientific

Sourced in United States

The cDNA Reverse Transcriptase Kit is a molecular biology tool designed to convert RNA into complementary DNA (cDNA). The kit contains the necessary reagents, including a reverse transcriptase enzyme, to perform this process, which is a crucial step in various gene expression analysis and other molecular biology applications.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (5 mentions) Sybr master mixture, by Thermo Fisher Scientific (3 mentions) Total rna extraction kit, by Omega Bio-Tek (3 mentions) Nanodrop 1000, by Thermo Fisher Scientific (2 mentions) Lightcycler, by Roche (2 mentions) Rneasy rna extraction kit, by Qiagen (2 mentions) Sybr green pcr master mix rox, by Roche (2 mentions) Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions) 7900ht fast real time pcr system, by Thermo Fisher Scientific (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Real time pcr system, by Thermo Fisher Scientific (1 mentions) Sybr green master mix, by Tiangen Biotech (1 mentions) Lightcycler 480 system, by Roche (1 mentions) Rnaeasy kit, by Qiagen (1 mentions) Rt2 profiler pcr array kit, by Qiagen (1 mentions) Enhanced chemiluminescence solution, by GE Healthcare (1 mentions) Cytochrome c, by Cell Signaling Technology (1 mentions) Neutral red, by Merck Group (1 mentions) Bcl2 associated x (bax), by Eurofins (1 mentions) Caspase 9, by Eurofins (1 mentions)

22 protocols using cdna reverse transcriptase kit

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The whole operations were performed in an RNA-free environment and used RNA-free tools. First, total RNA was extracted from cell or skin samples using TRIzol™ reagent (15596018, Life Technologies). Then, 1 μg RNA was used for reverse transcription by using a cDNA Reverse transcriptase kit (K1622, Thermo Scientific). The qPCR was performed in triplicate using SYBR green master mix (FP205-02, Tiangen) on Real-Time PCR System (Applied Biosystem 7,500, Life Technologies). GAPDH was used as the reference gene for normalization.

Tang L., Li T., Zhang B., Zhang Z., Sun X., Zhu Y., Feng B., Su Z., Yang L., Li H., Liu H., Chen Y., Dai Z., Zheng X., Li M., Li C., Zhao J., Qiu X., Ye S., Liu H., Zheng G., Li B, & Lu C. (2022). Punicalagin Alleviates Psoriasis by Inhibiting NF-κB-Mediated IL-1β Transcription and Caspase-1-Regulated IL-1β Secretion. Frontiers in Pharmacology, 13, 817526.

+ Open protocol

+ Expand

RNA Isolation and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation was performed using TRIzol Reagent according to manufacturer’s protocol. Purity and quantity of the extracted RNA were measured with the Nanodrop 1000 spectrophotometer (Thermo Fisher Scientific) and the ratios of absorbance at 260 and 280 nm (A_260/280) were consistently > 1.8. To synthesize cDNA, the cDNA reverse transcriptase kit (#4368813, Thermo Fisher Scientific) was used. Subsequently, RT-qPCR was performed using 5 ng of cDNA, SYBR Green PCR reaction mixture (Roche, Switzerland) and the following primer pairs: eNOS forward: AATCCTGTATGGCTCCGAGA and reverse: GGGACACCACGTCATACTCA, β2M forward: TTCTGGCCTGGAGGCTATC and reverse: TCAGGAAATTTGACTTTCCATTC. Analysis was performed in a 384-well plate on the LightCycler 480 system and software (Roche, Switzerland). Relative gene expression was calculated using the ΔC_T method. Data were presented as relative expression normalized to the experimental control.

Feenstra L., Kutikhin A.G., Shishkova D.K., Buikema H., Zeper L.W., Bourgonje A.R., Krenning G, & Hillebrands J.L. (2023). Calciprotein Particles Induce Endothelial Dysfunction by Impairing Endothelial Nitric Oxide Metabolism. Arteriosclerosis, Thrombosis, and Vascular Biology, 43(3), 443-455.

+ Open protocol

+ Expand

Quantitative Analysis of Metastatic Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from Panc-02 cells and tumors using an RNAeasy kit (Qiagen), and cDNA was produced using a cDNA Reverse Transcriptase Kit (ABI, New York, NY, USA) with 2 μg of RNA per reaction. For Panc-02 cells, qRT-PCR was carried out with 100 ng of cDNA per reaction using CCK-BR primers (Mm00432329_m1) and CCK-AR primers (Mm00438060_m1). For tumor RNA samples, qRT-PCR analysis was done using VEGFA primers (Mm01281449_m1). Both analyses used murine HPRT (Mm00446968_m1) as the internal control. RNA levels were calculated from the mean relative quantity (RQ = 2^−ΔΔC_T) with a 95 % confidence interval (CI; RQ = 2^{−(ΔΔC_T±CI)}). Multiple markers of metastatic tumor progression were initially assessed in tumors from vehicle-treated, high-fat diet mice versus devazepide-treated, high-fat diet mice using the mouse tumor metastasis RT² Pro-filer^™ PCR Array kit (Qiagen).

Matters G.L., Cooper T.K., McGovern C.O., Gilius E.L., Liao J., Barth B.M., Kester M, & Smith J.P. (2014). Cholecystokinin Mediates Progression and Metastasis of Pancreatic Cancer Associated with Dietary Fat. Digestive diseases and sciences, 59(6), 1180-1191.

+ Open protocol

+ Expand

Apoptosis Induction in Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

PC (Parry India Ltd, India) was dissolved in phenol red free DMEM to prepare a stock solution (200 μM) and stored at 4 °C. Dulbecco’s Modified Eagle Medium (DMEM), fetal bovine serum (FBS) and 0.25 % Trypsin-EDTA were procured from Invitrogen (Carlsbad, CA). Supplements for cell culture were purchased from Sigma Aldrich (St. Louis, MO) and Hi-media. (Mumbai, India) Neutral red was purchased from Sigma Aldrich (St. Louis, MO). Annexin V-FITC Apoptosis Detection Kit was purchased from BD Biosciences (San Jose, CA). The inhibitor cocktail was obtained from Pierce (Rockford, IL) and antibodies against ERK1/2, γH2AX (Ser 139), COX-2, cytochrome C, p-65, AKT and Vinculin were from Cell Signaling Technology (Beverly, MA). Respective secondary mouse, rabbit and goat antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). Enhanced chemiluminescence solution was from GE health care. Primers for Cyclin E, CDK-2, p-21, Bax, Bcl-2, Caspase 9, Mcl-1,MMP-9,VEGFR-2 and GAPDH were obtained from Eurofins (Luxembourg, Europe). C-DNA reverse transcriptase kit was procured from ABI (Carlsbad, CA) and SYBR green PCR master mix was from Roche (BASEL, Switzerland). Alexa Flour was from Life Technologies (Carlsbad, CA). PGE-2 kit was obtained from Cayman chemicals (Ann Arbor, MI). Matrigel was obtained from BD Biosciences (San Jose, CA, USA).

Ravi M., Tentu S., Baskar G., Rohan Prasad S., Raghavan S., Jayaprakash P., Jeyakanthan J., Rayala S.K, & Venkatraman G. (2015). Molecular mechanism of anti-cancer activity of phycocyanin in triple-negative breast cancer cells. BMC Cancer, 15, 768.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was prepared using High Pure RNA Isolation kit according to the manufacturer’s protocol (Roche). cDNA was synthesised using the cDNA Reverse Transcriptase kit (Life Technologies). The expression levels of target genes were quantitated by qPCR with FastStart Essential DNA Green Master (Roche) using the LightCycler and analysed with LightCycler^®96 Software (Roche Life Science). As an internal control, primers specific for Gapdh were used in real-time PCR analysis. The comparative cycle threshold method was used for data analyses and relative fold difference was expressed as 2−ΔΔCT.

Udugama M., Hii L., Garvie A., Cervini M., Vinod B., Chan F.L., Das P.P., Mann J.R., Collas P., Voon H.P, & Wong L.H. (2021). Mutations inhibiting KDM4B drive ALT activation in ATRX-mutated glioblastomas. Nature Communications, 12, 2584.

+ Open protocol

+ Expand

Quantitative Analysis of CHK1 mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was prepared according to the manufacturer's protocol (Roche) after 48 h of transfection and treated with DNAse using the Promega RQ1 reagent (Promega). cDNA was synthesized using the cDNA Reverse Transcriptase kit (Life Technologies). The level of CHK1 mRNA was quantitated with the FastStart DNA Green Sybr using the LightCycler (Roche). As an internal control, primers specific for Actin was used in real-time PCR analysis. Fold changes were calculated according to the manufacturer's instructions.
The DNA oligonucleotides used in real-time PCR analysis include:

CHK1 set#1: 5′ GCC TGA AAG AGA CTT GTG AGA AGT TGG G 3′ and 5′ TCC ATC ACC CTT AGA AAG CCG GAA 3′

CHK1 set #2: 5′ GTG AGA AGT TGG GCT ATC AAT GG 3′ and 5′ GAA CTC CAA TCC ATC ACC CTT AG 3′

Actin: 5′ GGC ATC CTC ACC CTG AAG TA 3′ and 5′ GGG GTG TTG AAG GTC TCA AA 3′

Chang F.T., Chan F.L., R. McGhie J.D., Udugama M., Mayne L., Collas P., Mann J.R, & Wong L.H. (2015). CHK1-driven histone H3.3 serine 31 phosphorylation is important for chromatin maintenance and cell survival in human ALT cancer cells. Nucleic Acids Research, 43(5), 2603-2614.

+ Open protocol

+ Expand

Quantitative RT-PCR for SARS-CoV-2 Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The protocol for RT-qPCR was previously described and briefly outlined here (61 (link)). RNA was reverse transcribed into cDNA with a high capacity cDNA Reverse Transcriptase Kit (Applied Biosystems). Target cDNA was amplified using specific primers, iQ SYBR Green Supermix (Bio-Rad) and QuantStudio 3 PCR system (Thermo Fisher). Host gene expression displayed as fold change over mock-infected samples was generated by first normalizing cycle threshold (Ct) values to 18S rRNA to generate ΔCt values (ΔCt = Ct gene of interest − Ct 18S rRNA). Next, Δ (ΔCt) values were determined by subtracting the mock-infected ΔCt values from the virus-infected samples. Technical triplicates were averaged, and means displayed using the equation 2^{−Δ (ΔCt)}. Graphed values are the mean of biological triplicates of each condition and technical triplicates of each sample. Host gene expression was quantified with the following primers (forward sequence/ reverse sequence): IFNB (GTCAGAGTGGAAATCCTAAG/ CAGCATCTGCTGGTTGAAG), IFNL1 (CGCCTTGGAAGAGTCACTCA/ GAAGCCTCAGGTCCCAATTC), OAS2 (TTCTGCCTGCACCACTCTTCACGAC/ GCCAGTCTTCAGAGCTGTGCCTTTG), IFIT1 (TGGTGACCTGGGGCAACTTT/ AGGCCTTGGCCCGTTCATAA), and 18S rRNA (TTCGATGGTAGTCGCTGTGC/ CTGCTGCCTTCCTTGAATGTGGTA). Virus genomes were quantified in reference to a standard curve, with primers for SARS-CoV-2 genomic nsp12/RdRp (GGTAACTGGTATGATTTCG/ CTGGTCAAGGTTAATATAGG).

Tanneti N.S., Patel A.K., Tan L.H., Marques A.D., Perera R.A., Sherrill-Mix S., Kelly B.J., Renner D.M., Collman R.G., Rodino K., Lee C., Bushman F.D., Cohen N.A, & Weiss S.R. (2024). Comparison of SARS-CoV-2 variants of concern in primary human nasal cultures demonstrates Delta as most cytopathic and Omicron as fastest replicating. mBio, 15(4), e03129-23.

+ Open protocol

+ Expand

Quantifying Islet Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Following a 16 hour recovery post-isolation, islets were collected and washed with PBS. RNA was isolated using the QIAGEN RNeasy RNA extraction kit. 100 ug of RNA was reverse transcribed into cDNA using a cDNA reverse transcriptase kit (Applied Biosystems). Quantitative PCR was performed in triplicate using the following primers: Cdk2: F (5′- AATTCTTCTGGGCTGCAAGTA-3′), R (5′-GGGTACACACTAGGTGCATTT-3′); Kcnj11: F (5′- GTGTCCAAGAAAGGCAACTG –3′), R (5′- GCACAGGAAGGACATGGTG –3′); normalized to a reference gene β-Actin: F (5′-GAGACCTTCAACACCCC-3′), R (5′GTGGTGGTGAAGCTGTAGCC-3′). SYBR Green PCR Master Mix (Rox) (Roche) was used with 1 μL of cDNA per reaction with a final primer concentration of 6 pM. Reactions were run on a StepOne Plus Real-Time PCR system (Applied Biosystems). PCR product specificity was determined by melt-curve analysis and gel electrophoresis. Data was reported as ΔΔCt.

Sdao S.M., Ho T., Poudel C., Foster H.R., De Leon E.R., Adams M.T., Lee J.H., Blum B., Rane S.G, & Merrins M.J. (2021). CDK2 limits the highly energetic secretory program of mature β cells by restricting PEP cycle-dependent KATP channel closure. Cell reports, 34(4), 108690.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expressions

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted with total RNA extraction kit (Zymo research). cDNA was synthesized using cDNA reverse transcriptase kit (Applied Biosystems), and then real-time PCR was performed in triplicate for each sample with 10 μl SYBR Master Mixture (Applied Biosystems) and the following primers: Arg1, 5’-GCTGTCTTCCCAAGAGTTGGG-3’ and 5’-ATGGAAGAGACCTTCAGCTAC-3’; iNOS, 5’-AACGGAGAACGTTGGATTTG-3’ and 5’-CAGCACAAGGGGTTTTCTTC-3’; COX2, 5’-CCAGCACTTCACCCATCAGTT-3’ and 5’-ACCCAGGTCCTCGCTTATGA-3’; PTGES, 5’-GCACACTGCTGGTCATCAAG-3’ and 5’-ACGTTTCAGCGCATCCTC-3’; HDAC1, 5’- CCAATGCTGAGGAGATGACCA-3’ and 5’-GCTTCACAGCACTTGCGAC-3’; HDAC2, 5’- AAGTGTGCTACTACTATGATGGTGA-3’ and 5’- TGAGGCTTCATGGGATGACC-3’; HDAC3, 5’- CACTATGGAGCTGGACACCC-3’ and 5’- TCAGAATGGAAGCGGCACAT-3’; HDAC8, 5’- CCTCAACTACATCAAAGGGAATCTG-3’ and 5’-ACAAACCGCTTGCATCAACA-3’; HDAC6, 5’- ATGGACGGGTATTGCATGTT-3’ and 5’-GCGGTGGATGGAGAAATAGA-3’; HDAC10, 5’- TCCATCCGAGTACCTTCCAC-3’ and 5’-GGCTGCTATGGCCACACTAT-3’; TGFb, 5’- AGCTGCGCTTGCAGAGATTA-3’ and 5’-ATTCCGTCTCCTTGGTTCAGC-3’; Actb, 5’-ATGGAGGGGAATACAGCCC-3’ and 5’-TTCTTTGCAGCTCCTTCGTT-3’ Expressions of the different genes were normalized to β-actin by the 2^−ΔCt method.

Hashimoto A., Fukumoto T., Zhang R, & Gabrilovich D. (2020). Selective targeting of different populations of myeloid-derived suppressor cells by histone deacetylase inhibitors. Cancer immunology, immunotherapy : CII, 69(9), 1929-1936.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted with a total RNA extraction kit (Omega Bio-tek). cDNA was synthesized (cDNA reverse transcriptase kit; Applied Biosystems), and PCR was performed in triplicate for each sample. To detect expression of Notch-, IRF8-, C/EBPα- or C/EBPβ-regulated genes, qRT-PCR was performed with 10 μl SYBR Master Mixture (Applied Biosystems) and the list of the primers is provided in Supplemental Table 2. Expressions of the different genes were normalized to β-actin. Relative expression was calculated using the 2^–ΔΔCt method.

Hashimoto A., Gao C., Mastio J., Kossenkov A., Abrams S.I., Purandare A.V., Desilva H., Wee S., Hunt J., Jure-Kunkel M, & Gabrilovich D.I. (2018). Inhibition of casein kinase 2 disrupts differentiation of myeloid cells in cancer and enhances the efficacy of immunotherapy in mice. Cancer research, 78(19), 5644-5655.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!