Longamp dna polymerase

Lentiviral packaging vectors pMD2.G and psPAX2 were a gift from Didier Trono (Addgene plasmids #12259 and #12260). CROPseq-Puro was a gift from Christoph Bock (Addgene plasmid #86708). UCOE-SFFV-dCas9-BFP-KRAB was a gift from Jonathan Weissman (Addgene plasmids #60955 and #85969).
CROPseq-Puro-F+E was cloned by replacing the original tracrRNA with the optimized F+E tracrRNA sequence^{41 (link)} using site-directed mutagenesis and Gibson assembly. One whole CROPseq-Puro spanning PCR was done with overlapping mutagenesis primers fwd 5’-TGT TTA AGA GCT ATG CTG GAA ACA GCA TAG CAA GTT TAA ATA AGG CTA GTC CGT TAT CAA CTT GAA AAA G and rev 5’-TAT TTA AAC TTG CTA TGC TGT TTC CAG CAT AGC TCT TAA ACA GAG ACG TAC AAA AAA GAG CAA GAA G using LongAmp DNA polymerase (NEB). The PCR product was DpnI digested to deplete residual unamplified circular CROPseq-Puro template. The digested and gel-purified PCR product was then circularized with Gibson assembly Mastermix (NEB) to generate CROPseq-Puro-F+E.

Chimeric mice were made by the aggregating clumps of approximately 6–12 ES cells with 8-cell stage CD-1 embryos (Gertsenstein et al., 2010 (link)). ES cells were grown in RESGRO culture medium (EMD Millipore) for 2 passages before aggregation. Embryos were transferred to recipient females and high percentage male chimeras were mated to C57BL/6N females to obtain mice heterozygous for the gene trap allele. Pups were genotyped by PCR. The primers used were: Rfx2 Fw1 = GGTCTGGAACCAACCCTT CT, Rfx2 Rv1 = CAGGATTCCTTGGCAACAGT, and LTRrev2 = CCAATAAACCCTCTT GCAGTTGC. The wild-type allele generates a 267 bp band and the gene trap allele generates a 139 bp band. The PCR cycling parameters were 95° C for 30 seconds, then 35 cycles at 95° C for 10 seconds, 60° C for 30 seconds, 65° C for 1 minute and a final extension at 65° C for 5 minutes using LongAmp DNA polymerase (New England Biolabs). Mice were maintained on both C57BL/6N and C57BL/6N x CD1 genetic backgrounds. All animal procedures were approved by The University of Texas at Austin Institutional Animal Care and Use Committee. Rfx2^gt/+ sperm on a C57BL/6N background is available from the Texas A&M Institute for Genomic Medicine knockout mouse repository.