Smarter cdna synthesis kit

Total RNA was extracted from the isolated GMARBs using the RNeasy Micro kit (QIAGEN, Venlo, Netherlands) according to the instructions provided by the manufacturer. The RNA was reverse-transcribed into full-length cDNA using the SMARTer cDNA Synthesis Kit (Takara Bio, Shiga, Japan) to avoid amplification bias related to primer variability. Briefly, the modified oligo (dT) primer 3′ SMART CDS Primer II A (Takara Bio) was used for the first-strand single-strand cDNA synthesis reaction. When SMART Scribe Reverse Transcriptase (Takara Bio) reaches the 5′ end of the mRNA, the enzyme’s terminal transferase activity adds a few nucleotides to the 3′ end of the single-strand cDNA. The SMARTer Oligonucleotide base pairs with a non-template nucleotide stretch are added, creating an extended template. SMART Scribe Reverse Transcriptase switches the templates and continues replicating to the end of the oligonucleotide^{21 (link),28 (link),29 (link)}. Double-strand cDNA was then synthesized using the Advantage 2 PCR Enzyme kit (Takara Bio).

Expanded cells were washed in PBS once and stained with the identical panel specified in ‘Analysis of bulk expanded cells’, except for CD48-FITC, which was used instead of CD34-FITC. Over 5000 cells per population were sorted into 1.5 ml tubes and subsequently lysed in 600 μl Trizol LS reagent (Thermo Fisher Scientific). RNA purification, library preparation and next-generation sequencing was performed by Tsukuba i-Laboratory, LLC. Libraries were prepared using the SMARTer cDNA synthesis kit (Takara) and the high-output kit v2 (Illumina), followed by sequencing on a NextSeq 500 sequencer (Illumina) at 2x 36 paired end reads. Data normalization and comparative analyses were performed with the DESeq2 package in R.⁴⁴ (link) Genes with an adjusted p <0.05 were considered differentially expressed. Enrichment analysis of differentially expressed genes was performed with the gene set enrichment analysis (GSEA) functions in the clusterProfiler package⁴⁵ (link) using molecular signature database (MSigDB) gene ontology biological process (C5 GO:BP) as well as chemical and genetic perturbations (C2:CGP) gene set collections. Heatmaps were generated with the ComplexHeatmap package.⁴⁶ (link)

For gene annotation of the genome, transcriptome sequencing was performed with mixed leaves and roots of a young seedling (14 days after imbibition). RNA was extracted with the TRIzol Reagent (Invitrogen, Waltham, MA, USA). The RNA quality was checked by a spectrophotometer (LabTech, Hopkinton, MA, USA) and a 2100 Bioanalyzer (Agilent Technologies, USA). The verified RNA was used for transcriptome sequencing library construction. Briefly, the mRNA was reversely transcribed using a Clontech SMARTer cDNA synthesis kit. A BluePippin Size Selection System (Pacific Biosciences of California, Menlo Park, CA, USA) was used to perform the size selection for the two libraries, sized 0–3 kb and 2–6 kb, respectively, after cDNA amplification and purification. The SMRTbell libraries were constructed according to the manufacturer’s protocol and sequenced on the PacBio SEQUEL II platform (Pacific Biosciences of California, Menlo Park, CA, USA). Last, we used SMRTLink 7.0 (https://www.pacb.com/support/software-downloads/) (accessed on 15 January 2022) to produce all the mRNA sequences for genome annotation.

Total RNA was extracted as described [44] (link), using RNAqueous-4-PCR (Life Technologies) and subsequently treated with Turbo-DNAase (Life Technologies) according to the manufacturer's instructions. Two step qRT-PCR was employed to measure RNAi knockdown. First-Strand cDNA was synthesized using the SMARTer cDNA synthesis kit (Clontech, Mt. View, CA) and amplified using the Brilliant II SYBR green qRT-PCR Master kit (Agilent Technologies, Santa Clara, CA) on an Applied Biosystems 3500 Genetic Analyzer according to the manufacturer's recommendations (omitting the cDNA synthesis step). Primers used for the amplification of SMDR2, SmMRP1 and 18S ribosomal RNA have been described previously [43] (link), [44] (link). Primers used for amplification of ABCA4 (Smp_056290) were: ABCA4-Sy1 (5′- GGGTGGTATGACAACAGCAA -3′) and ABCA4-Sy2 (5′- GAGCTGAAATTGGCCCTCTA -3′). Primers used for amplification of ABCB6 (Smp_134890) were: ABCB6-Sy1 (5′- TGCTATTGCCGCTGACATAC -3′) and ABCB6-Sy2 (5′- CCAATGCTGATGTAGCTTCG -3′). Primers used for amplification of MRP7 (Smp_147250) were: MRP7-Sy1 (5′- AGCTGGTGGGAGCAGTCTTA -3′) and MRP7-Sy2 (5′- ATCCAACTGGTGTGTGACGA -3′). Data were analyzed using the 2^−ΔΔC_t method [83] (link) to determine the relative expression ratio between target (transporters) and reference genes (18S RNA).

To identify potential transcripts present in abalone gonadal tissue, methods were adapted from the PacBio Iso-seq protocolto create cDNA libraries. Ovary and testes transcriptome libraries were prepared for PacBio sequencing. RNA was extracted from H. tuberculata ovary and testes samples by cesium chloride density gradient centrifugation (MacDonald et al., 1987 (link)). RNA samples were enriched for mRNA by using the Oligotext mRNA Mini Kit from Qiagen. Purified mRNA was used as the template for single stranded cDNA synthesis using the Clontech SMARTer cDNA Synthesis Kit. The cDNA was amplified by PCR using the AccuPrime High-Fidelity Taq system (Invitrogen, Carlsbad, CA, United States). Double stranded synthesis conditions were optimized with the following PCR program: °C for 2 min, followed by 20 cycles of 94°C for 30°s, 55°C for 30°s, and 68°C for 10 min. We used unique identifying barcoded PCR primers to amplify testes (barcode: CTGCGTGCTCTACGAC) and ovary (barcode: TCAGACGATGCGTCAT) cDNA. Because of size bias during PacBio sequencing, double stranded cDNA was fractionated using Ampure XP Beads (Beckman Coulter Life Sciences) into two fractions (Ratio of 4:1 of 0.45×: 0.6× size selection). Testis and ovary cDNA were sequenced using the PacBio RSII and was performed by the Washington State University Genomics Core.

Mental glands were collected from male P. shermani at six time points approximately every 3 weeks during 2010 (5/29, 6/19, 7/10, 8/1, 8/21, and 9/11). This range preceded and spanned the principal August mating season. Five glands were collected at each time point and immediately stored in RNAlater. Total RNA was extracted from individual glands using the RNeasy kit (Qiagen, Valencia, CA) following the manufacturer’s instructions. RNA concentrations were estimated by 260 nm absorbance. For each time point, standardized amounts of RNA were pooled from all five glands, and double-stranded cDNA prepared by oligo-dT priming using the SMARTer cDNA synthesis kit (Clontech, Palo Alto, CA). cDNA was supplied to Otogenetics Corporation (Norcross, GA) for library preparation and sequenced using the Illumina HiSeq 2000 platform (> 20 million reads per time point, 100-bp paired end reads). Data was deposited in the NCBI Sequence Read Archive (BioProject ID PRJNA427596).