Primescript 2 high fidelity one step rt pcr kit

HEV genomic RNA was reverse transcribed and cDNA was amplified by PCR using primers specific for 12 overlapping regions in the HEV genome (Table 1). Reverse transcription and first-round PCR were conducted using the PrimeScript II High Fidelity One Step RT-PCR Kit (Takara Bio, Inc., Shiga, Japan); second-round PCR was conducted using PrimeSTAR GXL DNA Polymerase (Takara Bio, Inc.). The 3′-Full RACE Core Set (Takara Bio, Inc.) was used to amplify core 3′ sequences. Final products were sequenced using a 3730xl DNA sequencer and the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA).

For JEV, CxFV-GFP, and ChinZIKV, viral RNA was extracted using PureLink RNA Mini kit (Thermo Fisher Scientific, Waltham, MA, USA) from the culture supernatant of infected Vero or C6/36 cells according to the manufacturer’s instruction. RT-PCR was performed to amplify viral genomic fragments with viral RNA as template using PrimeScript II High Fidelity One Step RT-PCR Kit (TaKaRa, Maebashi, Japan). The RT-PCR reaction mixture (50 μL) contained 25 μL of 2X One Step High Fidelity Buffer, 2 μL of each primer (10 μM), 1 μL of PrimeScript II RT Enzyme Mix, 4 μL of PrimeSTAR GXL for 1 step RT-PCR, 1 μL of viral RNA sample, and 15 μL of RNase Free dH₂O. Assays were performed using T100 Thermal Cycler (Biorad, Hercules, CA, USA) under the following cycling conditions: 45 °C for 10 min, 94 °C for 2 min, 30 cycles of 10 s at 98 °C, 15 s at 55 °C, and 30 s at 68 °C. The primers used are described in Table S1. The resulting DNA fragments were sequenced by Sanger sequencing at TsingKe Biotech. The prME coding sequence of ChinZIKV was sequenced after 6 passages in C6/36 cells. DNA fragments containing GFP region were reverse transcribed from serially passaged CxFV-GFP and were analyzed using gel electrophoresis.

To determine HRV types, the amplification of the VP4/VP2 (541 nucleotides) region of the viral genome was performed for HRV-positive samples using the PrimeScript II High-Fidelity One Step RT-PCR Kit (Takara Bio, Shiga, Japan) with previously reported primers [24 (link)]. After agarose gel purification with the QIAquick Gel Extraction Kit (Qiagen), PCR products were processed with the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) and analyzed using an ABI3500 capillary sequencer (Thermo Fisher Scientific) to obtain sequence data. Sequenced fragments were assembled manually using Bioedit software v7.2.5 (https://thalljiscience.github.io/). The genotypes of the detected strains were determined using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). RT-PCR for EV- and HCoV OC43-positive samples or PCR- for HAdV-positive samples were performed using the following primers: EV [25 (link)], HCoV OC43 [26 (link)], and HAdV [27 (link)], although it was difficult to amplify the viral genomes. Regarding PIVs, we did not attempt PCR on positive samples because their Ct values were >38.

Viral RNA was extracted from the cultured system as follows. First, virus particles in the cell culture supernatant were collected by centrifugation at 20,000 × g at 4°C for 1.5 h. The collected particles were suspended in 300 μL of RNAgents Denaturing Solution (Promega, Madison, WI, USA). Then, the RNA was purified by phenol-chloroform extraction. The gag-PR region (625–3402; positions based on HXB2 numbering) of the purified RNA was reverse transcribed using a PrimeScript II High Fidelity One Step RT-PCR Kit (Takara Bio Inc., Kusatsu, Japan). Subsequently, an inner gag-PR region (681–3348) was amplified by nested PCR using PrimeSTAR GXL DNA Polymerase (Takara Bio Inc.). The primer sets used for the amplification were as follows: reverse transcription PCR, 5′-ATCTCTAGCAGTGGC GCCCGAACAG and 5′-TAC TTCTGTTAGTGCTTTGGTTCC and nested PCR, 5′-CTCTCTCGACGC AGGACTCG and 5′-TAA TCCCTGCATAAATCTGACTTGC.

It was previously reported that the antiviral effect of favipiravir and ribavirin was correlated with the incorporation of a large number of mutations into viral genomes in other viruses [36 (link),74 (link),75 (link)]. To explain the mechanisms of HAV inhibition by favipiravir and ribavirin, we examined nucleotide mutations in the HAV genome by next-generation sequencing. We first extracted cellular RNA from HAV-infected Huh7 cells treated with or without favipiravir, ribavirin, or foscarnet sodium at 100 μM each for 72 h. We next amplified the target site by linker-added specific primers (Table 2) using a PrimeScript II High Fidelity One Step RT-PCR Kit (Takara). Each reaction was performed at 45 °C for 10 min and 94 °C for 2 min, followed by 45 cycles at 98 °C, 10 s for denaturation, 1 min at 60 °C for annealing, and 10 s at 68 °C for extension. The products were purified using a QIAquick PCR purification kit (Qiagen). Targeted deep sequencing was performed using an Illumina MiSeq System (Illumina K.K., Tokyo, Japan) at the instruction of Hokkaido System Science Co. Ltd. (Sapporo, Hokkaido, Japan).

Fecal specimens were adjusted to 10 wt% with phosphate-buffered saline and centrifuged at 10,000×g for 10 min at 4 °C. The nucleic acids were extracted from the supernatant using QIAamp Viral RNA Mini Kit (Qiagen). Subsequently, complementary DNA (cDNA) was prepared by reverse transcription using PrimeScript™ RT Reagent Kit (Perfect Real Time) (Takara Bio). It was then used for quantitative polymerase chain reaction (q-PCR), which was performed using the TaqMan probe PCR system as described previously [48 (link)].
All RNA for which HuNoV GI and GII were determined to be positive by q-PCR was amplified using the PrimeScript™ II High Fidelity One Step RT-PCR Kit (Takara Bio) with G1SKF/G1SKR and G2SKF/G2SKR primers, respectively [47 (link)]. The nucleic acid sequence of the PCR product was determined by direct sequencing using the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific). The resulting sequence was genotyped using the Norovirus Genotyping Tool [49 (link)]. If the genotypes were the same among samples collected in the same case, one sequence was selected, and a dataset of the gene sequence was prepared.