Dulbecco s modified essential medium
Dulbecco's modified essential medium (DMEM) is a cell culture medium commonly used to support the growth of various cell types, including mammalian cells. It is a balanced salt solution that provides essential nutrients, vitamins, and other components required for cell maintenance and proliferation.
Lab products found in correlation
50 protocols using dulbecco s modified essential medium
Isolation of Primary Dermal Fibroblasts
Culturing Thyroid Cancer Cell Lines
Antisense Oligonucleotide Modulation of CADM1 and ANK3
For antisense oligonucleotide (AON) treatment, cells were transfected at 24 hr with 10 μM of stated AON using Endo-porter transfection reagent (Gene-tools, US) as per manufacturers instructions. At 48 hr post-transfection cell media was removed and cells lysed and RNA extracted with Qiazol. All AONs were purchased from Gene-tools, US, and carried morpholino modifications. Sequences used were:
CADM1: | |
AON NS: | CCTCTTACCTCAGTTACAATTTATA |
AON-A1: | AGCACACATGAGAAGTATGACTTAC |
AON-A2: | ATCCAAGCATAAGATTGTCACTTAC |
ANK3: | |
AON NS: | CCTCTTACCTCAGTTACAATTTATA |
AON-A1: | TTTAAAATGGAAAACCAGCACTTAC |
AON-A2: | AATGGCCAATGCCAAGTTCACTTAC |
Isolation and Expansion of Fetal and Adult MSCs
Antisense Oligonucleotide Modulation of CADM1 and ANK3
Culturing Huh7 and HepG2 Cells
For experimental conditions, Interferon (IFN)‐alpha (IFN‐α), IFN‐gamma (IFN‐γ), N'‐hydroxy‐N‐phenyloctanediamide (SAHA) as well as ionomycin and phorbol 12‐myristate 13‐acetate (PMA) were obtained from Sigma‐Aldrich (St. Louis, Missouri, USA) and dissolved as described by manufacturer's instructions.
U87 Cell Culture Protocol
Cell Culture Conditions for Breast Cancer
Radioresistant Cancer Cell Preparation
For the experiments with SMLM, SkBr3 cells were prepared as described in detail elsewhere [72 (link)]. SkBr3 cells were grown in McCoy’s 5A cell medium, containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. Cells were cultivated and maintained at 37 °C in a humidified atmosphere at 95% air/5% CO2. Then, the cells were trypsinized and transferred to coverslips, put into six-well plates and further cultivated (about three passages, i.e., about 38 h) until 80% confluence.
Mesenchymal Stem Cell Culture and Nanomaterial Interaction
For fixed cell experiments, media was aspirated and samples were washed with phosphate buffered saline (PBS, Invitrogen) before fixing with 3.7% paraformaldehyde solution after 6 h of culture on nanoneedle arrays (NNAs). For visualization under an upright microscope, cells were incubated with 0.5μg/ml of wheat germ agglutinin (WGA) Alexafluor 488 Conjugate (Thermo Fisher Scientific) for 10 min and washed in PBS. For live experiments, cells were stained with WGA and then supplemented with Lebovitz-15 media at 37°C (Thermo Fisher Scientific).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!