M mlv microrna reverse transcription kit

Total RNA was extracted using RNAiso Plus (TaKaRa, Biotech Co., Ltd, Dalian, China). cDNA was synthesized using M-MLV MicroRNA Reverse Transcription Kit (Promega, USA). Real-time PCR was performed with SYBR Premix Ex TaqTM (TaKaRa, Biotech Co., Ltd, Dalian, China). PCR primer for miR-187 was TCGTGTCTTGTGTTGCAGC (forward) and GTGCAGGGTCCGAGGT (reverse). The expression levels were normalized to U6. PCR primer for U6 was CTCGCTTCGGCAGCACA (forward) and AACGCTTCACGAATTTGCGT (reverse). PCR was performed under the following conditions: 94°C for 4 min, followed by 40 cycles at 94°C for 30 s, 50°C for 30 s and 72°C for 40 s. Each sample was run in triplicate. The primers for CD276 and Dab2 were shown as follows. CD276, forward 5′-ACAGGAAGATGCTTCGAGGA-3′, reverse 5′-GAGACCTGGACTTCCACAGC-3′; Dab2, forward 5′-GTAGAAACAAGTGCAACCAATGG-3′, reverse 5′-GCCTTTGAACCTTGCTAAGAGA-3′; β-actin, forward 5′-ACTCGTCATACTCCTGCT-3′, reverse 5′-GAAACTACCTTCAACTCC-3′. Relative expressions were determined by normalizing expression of each Ct value to β-actin Ct value and data were analyzed according to the 2^−ΔΔCt formula.