P3 primary nucleofection solution

For each reaction, sgRNAs (Tsingke) were mixed with Cas9 (IDT) at a molar ratio of 2:1 (5 μL sgRNA100 μM + 4.1 μL Cas9 10 mg/mL). The synthesized sgRNA carried the fluorescent tag CY5. Cas9 protein and sgRNA were complexed by incubation at room temperature for more than 20 minutes. The mouse ATF5 sgRNA sequence was CAAGCCTGAATCCCCCGGCC, and the negative control sgRNA sequence was GTGTAGTTCGACCATTCGTG. For each reaction, 2-3×10⁶ progenitors were resuspended in 100 μl of P3 primary nucleofection solution (Lonza). The cell/RNP mix was then immediately loaded into the supplied nucleofector cassette cuvette (Lonza). The cuvette was inserted into the Lonza 4D-Nucleofector, and the nucleofection was performed. Next, 150-180 μL of pre-warmed medium was immediately added to each well of the cassette, which was then placed in a humidified 37°C/5% CO₂ incubator. After that, transfected cells were washed twice with PBS, and cells were further sorted by flow cytometry to obtain CY5-positive progenitors for colony-forming assays or in vitro differentiation experiments.

Two sgRNAs were designed to knock out a MCF7 enhancer (chr8:128,141,747–128,142,627, hg38) (sg1: GAAGTTGTAAGTATAGCGAG, sg2: AGTGCCTGGCACAAGGCAGA). sgRNAs were synthesized in vitro using the Precision gRNA Synthesis Kit (Invitrogen, A29377) according to the manufacturer protocol and concentrations were quantified with Nanodrop. To deliver genome editing machinery, 100 pmol of Cas9-NLS protein (QB3 MacroLab in University of California, Berkeley) and 120 pmol of in vitro synthesized gRNA were electroporated into 250,000 MCF7 cells with the P3 primary nucleofection solution (Lonza, V4XP-3024), using the DN-100 Lonza 4D-Nucleofector program. Cells were then plated into 6-well plates and cultured for 2 days, followed by plating into 96-well plates to pick single clones. Successful knockout clones were identified by genomic PCR with the primers forward: CACCAGGACTTGAAGGCAGC and reverse: CACTTCCCAACCTCAGTTTCC. RT-qPCR was used to quantify MYC expression (MYC forward primer: GTCCTCGGATTCTCTGCTCT, reverse primer ATCTTCTTGTTCCTCCTCAGAGTC) and normalized to the GAPDH expression level (GAPDH forward primer: ATTCCATGGCACCGTCAAGG, reverse primer TTCTCCATGGTGGTGAAGACG).