Ms 222 solution

Animals and Ethical Approval In vivo imaging was performed on four Xenopus laevis tadpoles at developmental stage 37/38, based on Nieuwkoop and Faber 1956. All experimental procedures were approved by the University of Kent Animal Welfare and Ethical Review Body (AWERB; Institutional Ethics Reference Number: 0037-SK-17). Reporting of all in vivo experimental work conforms with the ARRIVE guidelines.
Xenopus laevis embryos were supplied by the European Xenopus Resource Center (EXRC; Portsmouth UK). The Xenopus embryos were kept in water at 20 C until they reached the developmental stage 37/38^{37 (link)}. Prior to OS-PAM imaging, animals were anesthetized in $0.1\%$ MS-222 solution (ethyl 3-aminobenzoate methane sulfonate, Sigma-Aldrich UK^{39 (link)}. Animals remained anesthetised in MS-222 solution for the entire duration of the imaging procedure (4.2 min). All methods employed were performed in accordance with guidelines and regulations as described in the research protocol approved by the University of Kent Animal Welfare and Ethical Review Body.

This study was carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The experimental work was approved by the Institutional Animal Care and Use Committee of the University of California Irvine.
All of the experiments in this study were performed on wild type Mexican axolotls (Ambystoma mexicanum) measuring approximately 5−8 cm snout to tail tip (3−4 cm snout to vent). Experimental animals were either spawned at UC Irvine or obtained from the Ambystoma Genetic Stock Center at the University of Kentucky. Animals were anesthetized using a 0.1% MS222 solution (ethyl 3‐aminobenzoate methanesulfonate salt, Sigma, St. Louis, MO, USA), pH 7.0.

In vivo experiments were performed on the Xenopus laevis tadpole at developmental stage 37/38, based on Nieuwkoop and Faber 1956 [43 ]. Embryos were supplied by the European Xenopus Resource Centre (EXRC, Portsmouth UK) and kept at ∼20 °C in tap water. During the MS-PAM experiments, animals were anaesthetised in 0.1 % MS-222 solution (ethyl 3-aminobenzoate methanesulfonate, Sigma-Aldrich). All experimental procedures on stage 37/38 tadpoles are unregulated but were nevertheless approved by the University of Kent's animal welfare ethics committee.

Before examination, the fish was anesthesia using 0.0125% buffered MS-222 solution (ethyl 3-aminobenzoate methane sulfonic acid salt, Sigma-Aldrich, St. Louis, MI, USA). Total length and standard length were measured using Vernier calipers with 0.1 mm accuracy. Fish body weight was determined to an accuracy of 0.01 g. For morphological analysis, a digital CMOS X-ray detector (Model 2315, Dexela, London, UK), set to 45 kV and 120 mA, with 2.5 seconds of exposure, was used to view vertebrae of the fish [19 (link)].

Control measurements of the weight and length of the body of the fish were conducted at regular intervals (every three weeks) and at the end of the experiment. For this purpose, 30 fish from each variant were randomly caught and anesthetized using MS-222 solution with a concentration of 0.15 g/L (Sigma–Aldrich, Saint Louis, MO, USA). Body weight measurements were made on a scale with an accuracy of ±0.01 g (KERN ABJ; 440–49A, Balingen, Germany), and body length was measured using a caliper with an accuracy of ± 0.1 mm (Geko G01493, Radomsko, Poland). After the measurements, the fish were woken up in a tank with clean water and then transferred to the appropriate experimental tanks. The obtained measurement results were used to calculate growth indicators such as weight gain (WG; g), length gain (LG; cm), specific growth rate (SGR; %/d) and condition factor (K). The above parameters were calculated according to the Equations (2)–(5) [88 (link)].

WG—weight gain (g), FW—final weight (g), IW—initial weight (g)

LG—length gain (cm), FL—final length (cm), IL—initial lenght (cm)

SGR—specific growth rate (%/d), FW—final weight (g), IW—initial weight (g), T—number of days of rearing.

K—condition factor (g/cm³), BW—body weight (g), BL—body lenght (cm)

The PCR fragments amplified from genomic DNA using primers, 5’- TCCAGTTCACGAGCAGATTG and 5’- CCTTTTGACTGGCCATTAGC were digested using MnlI to identify the nar^j113-2B mutation in cpsf6 (Fig 2B). The 305bp or 225+80bp bands were observed in the products amplified from the wild-type and the nar^j113-2B alleles respectively after the restriction-enzyme digestion of the 418bp PCR products. For the genotyping of the live fish, 4mm² pieces of tail-fin were cut under anesthesia achieved by submerging in 0.03% MS222 solution (Sigma, #A5040), digested by a 1/5 volume of proteinase K in prepared under the conditions mentioned in the "Genetic linkage analysis" paragraph, and the crude extracts were used for the PCR templates at 1/10 volume of the final PCR reaction mixture. For genotyping of the embryos stained by the whole mount in situ hybridization, st.27 embryos were treated using the same conditions mentioned in the "Genetic linkage analysis" paragraph, and embryos at st.22 were digested by a 1/5 volume of proteinase K prepared the same as previously mentioned.

Adult females of the South African clawed frog Xenopus laevis were purchased from eNASCO (Fort Atkinson, United States) and kept in an aquatic housing system (XenoPlus, Tecniplast). All procedures were conducted in accordance with the New Zealand Animal Welfare Act and were approved by the Animal Ethics Committee of the University of Otago (approval numbers: 114/13 and 83/16).
Oocytes were extracted by partial ovariectomy under anesthesia via MS-222 solution (tricaine methane sulfonate, Sigma-Aldrich) with a concentration of 1.3 g/L (buffered to a neutral pH). Extracted ovary lobes were immediately placed in culture oocyte ringers solution (CulORi) containing in mM: 90 NaCl, 1 KCl, 2 CaCl₂, 5 HEPES, 2.5 Na⁺ pyruvate, 0.06 penicillin, 0.02 streptomycin, and in addition 50 μg/mL tetracycline, 100 μg/mL amikacin, 100 μg/mL ciprofloxacin, pH 7.4). For oocyte separation and removal of the follicle layer, the oocytes were incubated at room temperature for 90 min in collagenase (1.5 mg/mL dissolved in CulORi; Serva). Then, the oocytes were washed in Ca²⁺-free oocyte Ringer’s solution (containing in mM: 90 NaCl, 5 HEPES, 1 KCl, 1 EGTA, pH 7.4). Fully developed and healthy-looking stage V–VI oocytes (Dumont, 1972 (link)) were collected and stored individually in 96 well plates containing CulORi for further processing in an incubator at 17°C (Lab Companion).