Ezrin

Cells were washed (ice cold PBS) and lysed on ice with SDS sample buffer (4% SDS, 20% glycerol, 0.01% bromophenol blue, 0.125 M Tris-HCl, pH 6.8. Lysates were subjected to ultracentrifugation for 30 min (336,000 × g, TLA-100 rotor, Beckman Coulter), and soluble supernatants retained for downstream use, or frozen at −80°C. Protein quantification was performed as previously described [70 (link)].
For immunoblotting, membranes were probed with primary antibodies for 1 h in TTBS (50 mM Tris, 150 mM NaCl, 0.05% Tween 20) followed by appropriate secondary Abs coupled to horseradish peroxidase. Primary Abs for phospho-ERM (1:1000), Alix (1:1000) and N-cadherin (1:1000) and TGN46 (1:1000) were from Cell Signaling; for ezrin (1:5000) and β-actin (1:10000) from Sigma Aldrich; for CD63 (1:1000) and GFP (1:5000) from Calbiochem; for PS1 (1:1000) from Abcam; for TSG101 (1:1000) and flotillin 1 (1:1000) from BD Transduction Laboratories; for CD9 (1:1000) and annexin A7 (N-19, 1:1000) from Santa Cruz Biotechnology; for GAPDH (1:1000) from Merck Millipore; for PDPN from Acris Antibodies (NZ1, 1:1000). For E-cadherin and CD44 detection, the monoclonal Abs ECCD2 and HP2/9 (a generous gift of Dr. F. Sánchez-Madrid), respectively, were used at 1:1000 dilution. Peroxidase activity was developed using an enhanced chemiluminiscence kit as indicated by the manufacturer (Pierce).

EV samples isolated from equivalent volumes of urine were mixed with Laemmli Sample Buffer (Bio-Rad, Hercules, CA, USA) and subjected to SDS-PAGE using the Mini-Protean system (Bio-Rad, Hercules, CA, USA). Proteins were transferred to a PVDF membrane, which was then blocked with 5% skim milk powder (Sigma-Aldrich, St. Louis, MO, USA) for 1 h. Membranes were incubated overnight with primary antibodies at 4 °C. The next day, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (Jackson Immunoresearch, Ely, UK) in 5% skim milk powder for 1 h. Protein bands were detected with the SuperSignal West Dura kit (Thermo Fisher Scientific, Waltham, MA, USA).
The following primary antibodies were used: CD9 (ab92726, Abcam, Cambridge, UK), CD63 (H5C6, DSHB, Iowa City, IA, USA), CD81 (ANC-302-020, Nordic BioSite, Stockholm, Sweden), Alix (sc-53540, Santa Cruz, Dallas, TX, USA), Syntenin (ab133267, Abcam, Cambridge, UK), Tsg101 (612697, BD Biosciences, Franklin Lakes, NJ, USA), Ezrin (E8897, Sigma-Aldrich, St. Louis, MO, USA), Annexin 2 (610068, BD Biosciences, Franklin Lakes, NJ, USA), Uromodulin (sc-20631, Santa Cruz Biotechnology, Dallas, TX, USA), Albumin (MAB1455-SP, R&D Systems, Abingdon, UK).

Brain slices were incubated with antibodies against ATX (4F1 1:1000) [8 (link), 17 (link)], glial fibrillary acidic protein (GFAP, 1:1500), Ezrin (3C12 1:1000, Sigma Aldrich, Germany), vesicular glutamate transporter 1 (VGluT1) and vesicular GABA transporter (VGAT) (both 1:1000, Synaptic Systems, Germany) as described [8 (link)]. Electron microscopic studies were performed as described [4 (link)]. For 3,3’-diaminobenzidine (DAB) conversion, biotinylated secondary antibodies were used and DAB staining was performed as described earlier [4 (link), 18 (link)].

Non-polarized and polarized T84 cells were pretreated with or without the ezrin inhibitor NSC668394 (20 μM) for 1 h and incubated with GC with or without the inhibitor from the top chamber for 6 h, and then lysed by RIPA buffer [0.1% Triton x100, 0.5% deoxycholate, 0.1% SDS, 50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EGTA, 2 mM EDTA, 1 mM Na₃VO₄, 50 mM NaF, 10 mM Na₂PO₄, and proteinase inhibitor cocktail (Sigma-Aldrich, St. Louis, MO)]. Lysates were resolved using SDS-PAGE gels (BioRad) and analyzed by Western blot. Blots were stained for ezrin (Cell Signaling Technology) and phosphorylated ezrin at T567 (Abcam), stripped and reprobed with anti-β-tubulin antibody (Sigma). Blots were imaged using a Fujifilm LAS-3000 (Fujifilm Medical Systems). Each data point represents individual transwells. Two transwells from two to three independent experiments were quantified.

Anti-AKT1 (cat. 2938 s), -AKT2 (cat. 2964 s), -AKT3 (cat. 3788 s), -p-AKT (S473, cat. 4060 s), -ERM (cat. 3142 s), and -p-ERM (cat. 3141 s) antibodies were acquired from Cell Signaling (Danvers, MA, USA). Anti-GFP (cat. Sc-833s), -GST (cat. sc-138), -HA, -β-actin (cat. sc-47778), Anti-p-AKT (cat. Sc-514032), Id2 (cat. Sc- 398104) and -Id2 (cat. sc-489) antibodies were acquired from Santa Cruz Biotechnology (Dallas, TX, USA). Anti-FLAG (cat. F1804), -ezrin, -radixin, and -moesin antibodies were obtained from Sigma-Aldrich (St. Louis, MO, USA). Alexa Fluor 555 Phalloidin, Alexa Fluor 594 goat anti-rabbit and Alexa Fluor 488 goat anti-mouse secondary antibodies were obtained from Molecular Probes (Eugene, OR, USA). Anti-HSP70 was obtained from Abcam (Cambridge, MA, USA). siRNA (5’- GAGCUUAUGUCGAAUGAUAUU −3’) for silencing of Id2 was obtained from Genolution (Republic of Korea). siRNA (sense 5′- ACAGUUGGUUUACGUGAGGUCUU −3′, antisense 5′- GACCUCACGUAAACCAACUGUUU-3′) for silencing of radixin was obtained from Genolution (Republic of Korea). For RT-PCR primer for Nogo receptor (NgR) were 5’- TATCCCCAGTGTTCCTGAGC-3’ (forward) and 5’-GAGGTTGTTGGCAAACAGGT-3’ (reverse) obtained from cosmogenetech (Republic of korea). Cycloheximide (CHX) was purchased from Duchefa Biochemie (Haarlem, Netherlands). MG132 was obtained from Sigma (St. Louis, MO, USA).