7 500 fast real time pcr system mix

To ensure DNA integrity and to exclude the possibility of false negatives due to the presence of eventual inhibitors, the TaqMan RPP38 Control Reagents kit (Catalog number 4316844, Applied Biosystems, Foster City, CA, USA) was used as a reference amplification control following the manufacturer’s protocol. All reactions were performed in a MicroAmp Fast Optical 96-Well Reaction Plate using the 7,500 Fast Real-Time PCR System Mix (Applied Biosystems).

Total RNA was isolated using the Trizol (Life Technologies) according to the manufacturer’s protocol. RNA was reversed transcribed using the SuperScript® VILO™ cDNA synthesis kit (Life Technologies). The expression of CYR61, CTGF, ANKRD1, EDN1, CCNA, CDK1, and CYPA mRNA was evaluated in the 7500 Fast Real-Time PCR System Mix (Applied Biosystems, Foster City, California, USA), using Power SYBR Green PCR Master Mix (Applied Biosystems). The levels of gene expression were determined by normalizing to CYPA mRNA expression and expressed in relative mRNA level (2^ΔΔct). The values obtained from different experiments were averaged, and data are presented as means ± SD. The primers employed for real-time PCR are listed in Supplementary Table 2.

The MS-HRM was performed in triplicates with the bisulfite-treated DNA isolated from DBS or WB from each individual. It was performed in a MicroAmp Fast Optical 96-Well Reaction Plate using the 7,500 Fast Real-Time PCR System Mix (Applied Biosystems) with the primers 5′‐GGATTTTTGTATTGCGGTAAATAAG‐3′ and 5′‐CAACTAACCTTACCCACTCCATC‐3′ (forward and reverse, respectively) as previously described^{16 (link)}. The melting temperatures of 78 °C and 83 °C were chosen as a near-proportional amplification of unmethylated and methylated alleles, respectively. As described by Ferreira et al. (2019), the pair of primers used in this study act as a positive control for the bisulfite conversion, process due to the particularity of annealing in the treated DNA (Additional file 2: Figure S1).