Hindiii and noti restriction enzymes

The construct of stable expression vector CDH-GATA5 was as follows: the
full-length human GATA5 cDNA (residue 1-397, NCBI: NM_080473) was
synthesized and amplified by polymerase chain reaction (PCR) using the following
primers:
F: 5´-CCGAAGCTTGCCACCATGTACCAGAGCCT-3´
R: 5´-CGGGCGGCCGCCTAGGCCAAGGCCAGCGC-3´.
They were then ligated into the expression vector pCDH-CMV-MCS-EF1-coGFP (Systembio, USA)
by the HindIII and NotI restriction enzymes (Takara Bio Inc., China). The expression
vector was transfected into HCC cells by Lipofectamine 2000 (Invitrogen, USA). To obtain
the stable expression vector CDH-GATA5, Puromycin was used to screen the
stable cell clones. The transfected Bel7402 and PLC/PFR/5 cells with
CDH-GATA5 were respectively named Bel7402-CDH-GATA5and PLC/ PFR/5-CDH-GATA5.

pcDNA3.1‐GATA5 was constructed as follows. Full‐length human GATA5 cDNA (residue 1‐397, NCBI: NM_080473) was synthesized with a Kozak sequence GCCACC at the N‐terminus. Then, the synthetic cDNA was amplified by PCR using the following primer pairs: 5′CCGAAGCTTGCCACCATGTACCAGAGCCT‐3′ and 5′‐CGGGCGGCCGCCTAGGCCAAGGCCAGCGC‐3′. The HindIII and NotI restriction sites are underlined. The PCR product was digested with HindIII and NotI restriction enzymes (Takara Bio Inc, China) and ligated into the expression vector pcDNA3.1(+) (Invitrogen, USA). The stable expression vector CDH‐GATA5 construct was similar to the pcDNA3.1‐GATA5. The difference between them was that the CDH‐GATA5 vector colony was cloned into the pCDH‐CMV‐MCS‐EF1‐coGFP plasmid (SystemBio, USA) using restriction enzymes BamHI/EcoRI (Takara Bio Inc, China). The expression vector was transformed into Escherichia coli and used for amplification.
The transfection of GATA5 expression vectors into HCC cells was induced by Lipofectamine 2000 (Invitrogen). For stable expression vectors CDH‐GATA5, 400 mg/mL G418 was applied to screen stable cell clones, and the transfection of HLE, Bel7402 and PLC/PRF/5 cells was termed HLE‐GATA5, Bel7402‐GATA5 and PLC/PRF/5‐GATA5.