Brilliant 2 qpcr master mix

Expression levels of HIV LTR were analyzed using real-time, quantitative PCR. Reverse transcription was performed with the 2720 Thermal cycler (Applied Biosystems) using aliquots of total RNA extracted from samples. The cDNA samples were diluted to 20 ng/ul and gene-specific primers were used: forward and reverse LTR HIV-1 primers and Taqman LTR-HIV (Cat. #VC00021 and VC00023, Sigma–Aldrich). To normalize the fold changes in gene expression, two internal control genes were used, GAPDH Taqman primer (Cat. #4331182, Life technologies) and 18S rRNA (Cat. #4333760F, Applied Biosystems). Fold changes were calculated based on uninfected control. All real-time PCR reactions were performed using the MX3005P detection system (Agilent Technologies) and the amplifications were done using the Brilliant II QPCR Master Mix (Cat. #600804, Agilent Technologies). The thermal cycling conditions were composed of an initial denaturation step at 95°C for 10 min, 45 cycles at 95°C for 30 s and 55°C for 1 min. The experiments were carried out in duplicates for each data point. The relative quantification in gene expression was determined using the 2^-ΔΔCt method (Livak and Schmittgen, 2001 (link)).

Table 1 shows the probes and primers used in our real-time PCR assays. We used previously described primers and probes to detect B. burgdorferi and A. phagocytophilum (Courtney et al. 2004 (link)) and a new assay for B. microti with tick DNA detection as an internal control. The previously described assay was specific for Borrelia burgdorferi sensu lato and the analytical sensitivity was 50 borrelia spirochetes. The Babesia assay was specific for B. microti and the assay sensitivity was 40 copies of B. microti tubulin gene. We performed TaqMan real-time PCR assays in two duplex formats with 20 μL reaction volumes using the Brilliant II qPCR Master Mix (Agilent, La Jolla, CA) in a Stratagene MX3000P qPCR System. The first duplex detected tick DNA and B. burgdorferi, and the second duplex detected A. phagocytophilum and B. microti. In the first duplex, a probe that hybridizes to the 16S mtDNA gene in all hard tick species was used as an internal control. Cycling conditions included an initial activation of the Taq DNA polymerase at 95°C for 10 min, followed by 40 cycles of 15-s denaturation at 95°C, and 1-min annealing extension at 60°C.

Mouse liver, kidney (cortex and medulla), aorta, and heart were lysed in TRIzol and total ribonucleic acid (RNA) was purified by chloroform extraction and isopropanol precipitation. Reverse transcription (RT) was performed from 500 ng of total RNA with the Takara PrimeScript RT Reagent Kit (Ozyme, Saint Quentin en Yvelines, France). Primers and MGB-Taqman probes were purchased from ThermoFisher Scientific (Courtaboeuf, France) (
Supplementary Table S1). The polymerase chain reaction (PCR) reaction mixture was prepared using the Brilliant II QPCR Master Mix (Agilent Technologies, Les Ulis, France). All PCR reactions were performed in a Mx3000P (Agilent Technologies). The data were acquired and analyzed with the MxPro software (Agilent Technologies). Target gene expression was normalized on the basis of the hypoxanthine phosphorobosyltransferase (HPRT) content of each sample and was subsequently normalized to a basal mRNA level with the equation: N target = 2 ΔCt sample, where ΔCt is the Ct value of the target gene minus the Ct value of the HPRT gene. Normalized mRNA levels were determined by dividing the N target value by the N target value of the smallest quantifiable amount of target gene mRNA (target gene Ct value = 35). Data were then expressed as “fold induction” versus control.

Taqman real-time PCR assays were performed in a duplex format (to detect DNA of tick and B. burgdorferi) with a reaction volume of 20 μl, by using the Brilliant II QPCR Master Mix in a Stratagene MX3000P QPCR System (Agilent, La Jolla, Calif.). The detection of tick DNA served as an internal control with 300 nM of primers Tick16S_F (5′-AATACTCTAGGGATAACAGCGTAATAATTTT -3′) and Tick16S_R (5′-CGGTCTGAACTCAGATCAAGTAGGA-3′), and 125 nM of Tick16S_Probe (FAM-5′- AAATAGTTTGCGACCTCGATGTTGGATTAGGAT 3'- BHQ1). The detection of B. burgdorferi was modified from (Courtney et al. 2004) with 700 nM primers Borrelia23S_F (5′-CGAGTCTTAAAAGGGCGATTTAGT-3′) and Borrelia23S_R (5′-GCTTCAGCCTGGCCATAAATAG-3′), and 300 nM of Borrelia_Probe (HEX-5′- AGATGTGGTAGACCCGAAGCCGAGTG-3′-BHQ1). Cycling conditions included an initial activation of the Taq DNA polymerase at 95 °C for 10 min, followed by 40 cycles of a 15 s denaturation at 95 °C and a 1 min annealing-extension step at 60 °C.

The reverse transcription reaction was performed using an AffinityScript QPCR cDNA Synthesis Kit (Agilent Technologies, Santa Clara, CA, USA). Briefly, total RNA (3 μg) was reverse transcribed using random primers according to the manufacturer's instructions. cDNA aliquots were used for quantitative PCR analysis. Real-time PCR was performed using TaqMan probes with Brilliant II QPCR Master Mix (Agilent) according to the manufacturer's instructions. TaqMan Gene Expression Assay reagents (Thermo Fisher Scientific, Waltham, MA, USA) for aromatase (Assay ID: Mm00484049_m1) and β-actin (Assay ID: Mm01205647_g1) were used as TaqMan probes. Real-time PCR was performed using a two-step cycling protocol consisting of 45 cycles of 20 s at 95°C and 60 s at 60°C on an Mx3000P QPCR System (Agilent). All reactions included controls lacking the template. After the reactions, the Ct values were determined using fixed-threshold settings. The ΔΔCT method was used to determine the mRNA fold change, which was normalized to β-actin mRNA level. Each experiment was performed in duplicate and repeated at least three times.