The largest database of trusted experimental protocols

Mir 143 mimic

Manufactured by GenePharma
Sourced in China

MiR-143 mimics are synthetic RNA molecules designed to mimic the function of the natural microRNA miR-143. MicroRNAs are small, non-coding RNA molecules that play crucial roles in regulating gene expression. The MiR-143 mimics are intended for use in research applications to study the biological functions and potential therapeutic applications of miR-143.

Automatically generated - may contain errors

6 protocols using mir 143 mimic

1

Silencing SIRT1 and Overexpressing Beclin-1 in PMVECs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviruses expressing short hairpin RNA to silence SIRT1 (sh-SIRT1), oe-SIRT1, or oe-Beclin-1, as well as miR-143 mimic, were constructed by GenePharma. The sequences are indicated in Supplementary Table 1. For lentivirus packaging, 293T cells were cultured in a DMEM complete medium containing 10% FBS and passaged every other day. When PMVECs were in a logarithmic growth phase, they were detached by trypsin and triturated to make 5 × 104 cells/mL cell suspension and seeded into 6-well plates with 2 mL per well. The cells were cultured overnight at 37° C, virus (1 × 108 TU/mL) was added into the cells for infection, and stably transduced cells were obtained for subsequent tests. miR-141-3p mimic (sense-5’-UAACACUGUCUGGUAAAGAUG-3’; antisense-5’-CAUCUUUACCAGACAGUGUUA-3’) and mimic NC (sense-5’-UCACAACCUCCUAGAAAGAGUAGA-3’; antisense-5’-UCUACUCUUUCUAGGAGGUUGUGA-3’) were transduced using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA).
+ Open protocol
+ Expand
2

Extracellular Vesicles Modulate Osteosarcoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MG63 cells and U2OS cells were obtained from Cell Resource Center, Shanghai Institutes for Biological Sciences, the Chinese Academy of Sciences (Shanghai, China), and then incubated in DMEM (GIBCO) containing 10% FBS and 1% penicillin-streptomycin at 37°C and 5% CO2. The cells were assigned into blank group, NC group, EVs group, EVs-si-NC group, EVs-si-MALAT1 group, EVs + mimic-NC group and EVs + miR-143 mimic group. The EVs group was intervened with different concentrations of EVs (25 μg/mL, 50 μg/mL and 100 μg/mL). The blank group and NC group were cultured with PBS and the supernatant of GW4689-treated BMSCs culture medium, respectively. The EVs-si-NC group and EVs-si-MALAT1 group were treated with 100 μg/mL EVs-si-NC and EVs-si-MALAT1, respectively. The EVs + mimic-NC group and EVs + miR-143 mimic group were transfected with mimic-NC and miR-143 mimic (GenePharma), respectively, and then treated with 100 μg/mL EVs. The cell transfection was performed in line with the instructions of Lipofectamine™ 3000 (Invitrogen). The subsequent experiments were conducted after 48 h of transfection.
+ Open protocol
+ Expand
3

Transfection of miR-143 Inhibitor and Mimics

Check if the same lab product or an alternative is used in the 5 most similar protocols
Diluted inhibitor-NC, miR-143 inhibitor, mimics-NC or miR-143 mimics (Genep-harma, Shanghai, China) were mixed with diluted Opti-MEM® I Reduced Serum Medium (Gibco, New York, NY, USA) and then stand for 20 min. The mixture was used to transfection. miR-143 mimics: 5′ UGAGAUGAAGCACUGUAGCUC 3′, 5′ GCUACAGUGCUUCAUCUCAUU 3′. MiR-143 inhibitor: GAGCUACAGUGCUUCAUCUCA. ATG7 siRNA: GCUAGAGACGUGACACAUATT, UAUGUGUCACGUCUCUAGCTT.
+ Open protocol
+ Expand
4

Porcine TGF-β1 Signaling Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols
Porcine TGF-β1 was purchased from R&D Systems (Minneapolis, MN, USA). Antibodies against PKA, ERK1/2, and p-ERK1/2 were obtained from Sangon Biotech (Shanghai, China), those against AKT and p-AKT were from Cell Signaling Technology (Beverly, MA, USA), and those against FSHR and GAPDH as well as anti-rabbit and anti-mouse IgG were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). DMEM-F-12, fetal bovine serum (FBS), and phosphate-buffered saline were obtained from Life Technologies (Carlsbad, CA, USA). Lipofectamine 2000 was purchased from Invitrogen (Carlsbad, CA, USA). Protease and phosphatase inhibitors were obtained from Roche (Basel, Switzerland). miR-143 mimics, miR-143 inhibitors, and siRNAs were all synthesized by GenePharma (Shanghai, China) (Supplementary Table S1).
+ Open protocol
+ Expand
5

Investigating SBF2-AS1 and miR-143 in Breast Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
MDA-MB-231 and MCF-7 cells were selected to explore the impacts of SBF2-AS1 on BC cells, which were separated into 7 groups: the blank group (the cells without any transfection); the si-negative control (NC) group (cells were transfected with silenced SBF2-AS1 NC vector); the si-SBF2-AS1 group (cells were transfected with silenced SBF2-AS1 vector); the Mimics NC group (cells were introduced with miR-143 Mimics NC); the miR-143 mimics group (cells were introduced with miR-143 mimics); the overexpressed (oe)-SBF2-AS1 + Mimics NC group (cells were transfected with oe-SBF2-AS1 vector and miR-143 Mimics NC); the oe-SBF2-AS1 + miR-143 mimics group (cells were transfected with oe-SBF2-AS1 vector and miR-143 mimics). Mimics NC, miR-143 mimics, si-NC, si-SBF2-AS1 and oe-SBF2-AS1 were all designed and synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). The medium was changed to the serum-free medium that without penicillin and streptomycin in the transfection. According to the instructions of Lipofectamine™ 2000 reagent, the silcenced or overexpressed plasmids, and mimics or its NC were mixed and placed for 20 min. The medium was replaced by normal complete medium after the cells were transfected for 6–8 h.
+ Open protocol
+ Expand
6

Oral Cancer Cell Lines Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human OSCC cell lines (SCC-4, SCC-9, SCC-25, and Tca8113), and a human normal oral keratinocyte cell line (hNOK) were obtained from the Beijing Institute for Cancer Research (Beijing, China) and maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA), 100 U/mL penicillin, and 100 μg/ mL streptomycin. All cells were incubated at 37°C in a humidified atmosphere with 5% CO 2 . For RNA transfection, the cells were seeded into each well of a 24-well plate and incubated overnight, then transfected with either miR-143 mimics (GenePharma, Shanghai, China) or negative control (NC) RNA-oligonucleotides (GenePharma) using Lipofectamine 2000 (Invitrogen) in accordance with the manufacturer procedure.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!