Am9858

IAV samples were pH-adjusted and neutralized as described above, using 1 × pH buffers. Samples were pH exposed for 30 s at an ambient room temperature prior to neutralization. As a control, virus was mixed with PBS only and held at an ambient temperature. Neutralized and control whole-virus samples were then diluted 1/100 into RNase digestion mixture [TE buffer with 10 mM Tris and 1 mM EDTA (Invitrogen, AM9858), supplemented with 50 mM NaCl, pH adjusted to 7.0, and with HCl. RNase A/T1 (Thermo-Scientific, EN0551) was then added for 40 µg/mL RNase A and 100 U/mL T1 final concentrations). Samples were vortexed to mix and statically incubated at 37°C for 30 min. As controls, identical neutralized samples were diluted 1/100 into control digestion mixture (PBS added to TE buffer in the absence of RNase A/T1), vortexed, and incubated alongside RNase-treated samples. After 30 min, SUPERase-In RNase Inhibitor (Invitrogen, AM2694, acts against RNase A, B, C, 1, T1) was added to all samples and incubated at room temperature for 20 min. Samples were then frozen at −20°C overnight prior to RNA extraction using the QIAamp Viral RNA Mini Extraction Kit (Qiagen, 52906) according to the manufacturer’s instructions. Viral RNA was stored at −80°C until analysis.

For every reaction, 5 µl Dynabeads MyOne Streptavidin T1 (Invitrogen, 65602) were washed twice with 1.45 µl washing solution containing 100 mM NaOH (Sigma-Aldrich, S8045-500G), 50 mM NaCl (Ambion, AM9760G), and UltraPure DNase/RNase-Free Distilled Water (Invitrogen, 10977035). The beads were then washed with 1.45 µl RNAse-free bind and wash solution containing 0.01 mM Tris (Invitrogen, AM9855G), 1 mM EDTA (AM9260G), 2 M NaCl (Ambion, AM9760G), and UltraPure DNase/RNase-Free Distilled Water (Invitrogen, 10977035). The beads were then mixed with 2 µl RNAse-free bind and wash solution and 0.1 µl oligo-dT (IDT, 5′-/5BiotinTEG/AAGCAGTGGTATCAACGCAGAGTA CT₃₀VN-3′) and incubated in ambient temperature for 15 min. The beads were finally stored in 1 µl 1% BSA (Ambion, AM2616) in TE buffer (Invitrogen, AM9858) and incubated on a rotator overnight at 8 °C. Before use, the buffer was exchanged with RNA and Protein lysis buffer.