Goscript reverse kit

RNA was isolated with the TRI reagent (Sigma-Aldrich, USA) according to the manufacturer's recommendations. Parts of small intestine (duodenum, jejunum and ileum) or colon (proximal, distal) were pooled together into one sample from all animals. The appropriate RNA was transcribed into cDNA using GoScript™ Reverse kit (Promega, USA).
For expression profiling of Ub-ligase genes, kit RT2 Profiler PCR Arrays (Qiagen, USA) was used with different specific primer pair for each gene of E3-Ub ligase placed in each position that allows to measure 370 genes simultaneously. Chosen genes represent Ub-ligases and that could be potential drug targets. This array includes ubiquitin ligases from all major E3 families and important regulatory ubiquitination-related genes with suggested redundant or compensating functions that are not Ub-ligases by the nature, but could possibly cause lower drug efficacy or off-target effects. Internal controls for reference genes and detecting genomic DNA contamination were included within the plate: housekeeping genes (GAPDH, HSP90, beta-actin, Gus-B, beta-2 microglobulin), genomic DNA contamination control and positive PCR controls (see manufacturer's handbook).

The levels of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) transcripts and of cel-miR-39-3p in samples were evaluated using reverse transcription quantitative real-time PCR (qPCR). More in detail, the same quantity of each sample was reverse transcribed using GoScript Reverse Kit (Promega) and GAPDH transcript levels were subsequently amplified with StepOne system (Applied Biosystems), using Syber Green master mix (GoTaq qPCR Master Mix Kit, Promega) and specific primer pairs (forward primer: AACTTTGGTATCGTGGAAGGA; reverse primer: GGCAGTGATGGCATGGAC) (Barba et al., 2012 (link); Di Pietro et al., 2017 (link)). In parallel, total RNAs were also used as templates for miRNA reverse transcription, using TaqMan^TM Advanced miRNA cDNA Synthesis Kit (ThermoFisher), according to the manufacturer’s instructions. cel-miR-39-3p levels were amplified using TaqMan^TM Fast Advanced Master Mix (ThermoFisher) and a specific TaqMan^TM Advanced miRNA Assay (Assay ID#478293_mir, ThermoFisher).

RNA was purified from lung homogenates by using Trizol extraction protocol. Reverse transcription of RNA into cDNA was carried out with Go script reverse kit (Promega). RT-PCR was performed with Fast SYBR Green master mix on an ARIA MX (Stratagene MX3005P, Agilent technologies). Primers were synthetized (Qiagen, Hilden, Germany). The expression of pro-IL-18 and Mmp12 mRNA, relative to housekeeping 18S mRNA, were analyzed using Quantitect gene expression assays (Qiagen). For all experiments, biological quadruplicate and technical triplicate were performed.