Tissue specimens were thawed and processed, as previously described (14 (link)) and as shown in Figure 1 Figure 1
Facsaria 3 sorp cell sorter
Manufactured by BD
The BD FACSAria III SORP cell sorter is a high-performance flow cytometry instrument designed for cell sorting. It features advanced optics, fluidics, and electronics to enable precise separation of cells based on their physical and fluorescent characteristics.
Automatically generated - may contain errors
Lab products found in correlation
Facsdiva software, by BD (5 mentions)
7 aad viability dye, by Thermo Fisher Scientific (4 mentions)
Pre sort buffer, by BD (4 mentions)
Fcr blocking reagent, by Miltenyi Biotec (3 mentions)
Cd33 fluorescein isothiocyanate clone him3 4, by BD (2 mentions)
Cd14 phycoerythrin cy7 clone m5e2, by BD (2 mentions)
Cd15 allophycocyanin clone hi98, by BioLegend (2 mentions)
Hla dr phycoerythrin clone g46 6, by BD (2 mentions)
Cd3 allophycocyanin cy7 clone sk7, by BD (2 mentions)
Lsrfortessa cell analyzer, by BD (2 mentions)
Il 25, by R&D Systems (2 mentions)
Il 33, by R&D Systems (2 mentions)
Interleukin 7 (il 7), by R&D Systems (2 mentions)
Interleukin 2 (il 2), by R&D Systems (2 mentions)
Multiplex luminex assay, by Eve Technologies (2 mentions)
Gentlemacs dissociator, by Miltenyi Biotec (1 mentions)
Fcr blocker, by Miltenyi Biotec (1 mentions)
Lsrfortessa x 20 flow cytometer, by BD (1 mentions)
Cd4 phycoerythrin clone rpa t4, by BD (1 mentions)
Cd8 fluorescein isothiocyanate clone rpa t8, by BD (1 mentions)
14 protocols using facsaria 3 sorp cell sorter
1
Isolation and Sorting of Myeloid Cells from Colorectal Cancer Tissues
2
Multicolor Flow Cytometry Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells isolated from tissues were washed with PBS and re-suspended in 100 μl flow cytometry staining buffer (PBS with 1% FCS and 0.1% sodium azide). Fc receptors (FcR) were first blocked using FcR Blocker (Miltenyi Biotech, Bergisch Gladbach, Germany). 7-AAD viability dye (eBioscience, San Diego, USA) was used to gate live cells. Cells were then stained with cell surface antibodies against CD33-Fluorescein isothiocyanate (clone HIM3-4; BD Biosciences, Oxford, UK), CD14-phycoerythrin-Cy7 (clone M5E2; BD Biosciences), CD15-allophycocyanin (clone HI98; BioLegend, San Diego, USA), HLA DR-phycoerythrin (clone G46-6; BD Biosciences) or CD11a-phycoerythrin (clone G43-25B; BD Pharmingen, San Jose, USA) and incubated at 4 °C for 30 min. Cells were then washed twice with flow cytometry staining buffer and data were acquired by BD LSRFortessa X-20 flow cytometer (BD Biosciences).
For sorting, cells were re-suspended in Pre-Sort buffer (BD Biosciences). BD FACSAria III SORP cell sorter with BD FACSDiva software (BD Biosciences) was used. Applicable measures were taken to ensure minimal sorter-induced cell stress (SICS). Data analyses were performed on FlowJo V10 software (FlowJo, Ashland, USA).
For sorting, cells were re-suspended in Pre-Sort buffer (BD Biosciences). BD FACSAria III SORP cell sorter with BD FACSDiva software (BD Biosciences) was used. Applicable measures were taken to ensure minimal sorter-induced cell stress (SICS). Data analyses were performed on FlowJo V10 software (FlowJo, Ashland, USA).
3
Isolation of CD4+ and CD8+ TILs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single cell suspensions from TT specimens were resuspended in 100 µL of flow cytometry staining buffer (PBS with 1% FCS and 0.1% sodium azide). An FcR Blocking Reagent (Miltenyi Biotec) was used to block Fc receptors (FcR) and a 7-AAD viability dye (eBioscience, San Diego, CA, USA) was used to gate live cells. Cells were stained with surface antibodies against CD3-allophycocyanin-Cy7 (clone SK7, BD Pharmingen, San Jose, CA, USA), CD4-phycoerythrin (clone RPA-T4, BD Pharmingen), and CD8-fluorescein isothiocyanate (clone RPA-T8; BD Pharmingen). Cells were washed twice with flow cytometry staining buffer prior to re-suspension in Pre-Sort buffer (BD Biosciences, Oxford, UK). A BD FACSAria III SORP cell sorter on BD FACSDiva software (BD Biosciences) was used for sorting pure CD4+ (7AAD−CD3+CD4+CD8−), and CD8+ (7AAD−CD3+CD4−CD8+) TILs. Relevant procedures were followed to ensure minimum sorter-induced cell stress (SICS), as previously described [18 (link)]. Flow cytometric analyses were performed on FlowJo V10 software (FlowJo, Ashland, OH, USA).
4
Lentiviral Transduction and Cell Sorting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Flow cytometry cell sorting experiments were carried out using HS27A-Turquoise and ML2-Cherry. Briefly, the lentivirus expressing mTurquoise2-Tubulin was constructed by cloning the mTurquoise2-Tubulin sequence from pmTurquoise2-Tubulin (a gift from Gadella Dorus, Addgene plasmid #36202 (ref. 58)) into the CSII-EF-MCS vector. Lentiviruses were produced in 293 T cells by transfecting lentiviruses with the helper plasmids pMD2.G and psPAX2 (a gift from D. Trono, Addgene plasmids #12259 and #12260), following Addgene's instructions. Recipient cells were infected at a low multiplicity of infection (moi < 1) and finally sorted on a BD FACSAria III SORP cell sorter.
After 3 days of confinement, the HS27A-Turquoise and ML2-Cherry cells were analyzed using the BD LSRFortessa cell analyzer.
After 3 days of confinement, the HS27A-Turquoise and ML2-Cherry cells were analyzed using the BD LSRFortessa cell analyzer.
5
CAR-T Cell Expansion and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CAR-T cells were cultured in AIM-V medium (Gibco) supplemented with 10% autologous human serum and 100 IU/mL human IL-2 (PeproTech). Irradiated (100-gray) RPMI-8226 cells were used to stimulate CAR-T cells at a ratio of 1:1 (CAR+T cells:RPMI-8226 cells) for the first time on day 9 after viral transduction. The cells were monitored daily and fed according to the cell count every 3 days. After four rounds of stimulation, the CAR-T cells were subjected to apoptosis and T-cell subset analyses, and CAR+T cell sorting was performed using a BD FACSAria III SORP cell sorter for RNA-seq analysis.
6
Flow Cytometry Profiling of PBMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PBMCs were washed with PBS and re-suspended in 100 µl flow cytometry staining buffer (PBS with 1% FCS and 0.1% sodium azide). Fc receptors (FcR) were first blocked using FcR Blocking Reagent (Miltenyi Biotech, Bergisch Gladbach, Germany). 7-AAD viability dye or Fixable Viability Dye eFluor™ 780 (eBioscience, San Diego, USA) was used to gate live cells. Cells were then stained with cell surface antibodies against CD33-FITC (clone HIM3-4; BD Biosciences, Oxford, UK), HLA-DR-PE (clone G46-6; BD Biosciences), TIM-3-BV711 (clone 7D3; BD Horizon), PD-1-PE-CF594 (clone EH12.1; BD Pharmingen), galectin-9-PerCP (clone 9M1-3; Biolegend) and PD-L1-APC (clone MIH1; BD Pharmingen), and incubated at 4°C for 30 min. Cells were then washed twice with flow cytometry staining buffer and data were acquired using BD LSRFortessa X-20 SORP flow cytometer (BD Biosciences).
For sorting, cells stained with 7-AAD, CD33 and HLA-DR were re-suspended in Pre-Sort buffer (BD Biosciences). Cell sorting was performed on BD FACSAria III SORP cell sorter with BD FACSDiva software (BD Biosciences). Applicable measures were taken to ensure minimal sorter-induced cell stress (SICS). Data analyses were performed on FlowJo V10 software (FlowJo, Ashland, USA).
For sorting, cells stained with 7-AAD, CD33 and HLA-DR were re-suspended in Pre-Sort buffer (BD Biosciences). Cell sorting was performed on BD FACSAria III SORP cell sorter with BD FACSDiva software (BD Biosciences). Applicable measures were taken to ensure minimal sorter-induced cell stress (SICS). Data analyses were performed on FlowJo V10 software (FlowJo, Ashland, USA).
7
Single-cell Sorting of CD33+ Monocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single-cell suspensions from TT were resuspended in 100-µl flow cytometry staining buffer (PBS with 1% FCS and 0.1% sodium azide). Fc receptors (FcR) were blocked using FcR Blocking Reagent (Miltenyi Biotech, Bergisch Gladbach, Germany), and 7-AAD viability dye (eBioscience, San Diego, USA) was used to gate live cells. Cells were stained with cell surface antibodies against CD3-allophycocyanin-Cy7 (clone SK7, BD Pharmingen, San Jose, USA) and CD33-allophycocyanin (clone WM53, BD Pharmingen). Cells were washed twice with flow cytometry staining buffer and re-suspended in Pre-Sort buffer (BD Biosciences). BD FACSAria III SORP cell sorter on BD FACSDiva software (BD Biosciences) was used for sorting pure CD33+(7AAD–CD3–CD33+) populations. Relevant procedures were followed to ensure minimum sorter-induced cell stress (SICS), as previously described [15 (link)]. Flow cytometric representations were performed on FlowJo V10 software (FlowJo, Ashland, USA).
8
Dual-color fluorescence cell sorting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Flow cytometry cell sorting experiments were carried out using HS27A-Turquoise and ML2-Cherry. Briefly, the lentivirus expressing mTurquoise2-Tubulin was constructed by cloning the mTurquoise2-Tubulin sequence from pmTurquoise2-Tubulin (a gift from Gadella Dorus, Addgene plasmid #36202 46 ) into the CSII-EF-MCS vector. Lentiviruses were produced in 293T cells by transfecting lentiviruses with the helper plasmids pMD2.G and psPAX2 (a gift from D. Trono, Addgene plasmids #12259 and #12260), following Addgene's instructions. Recipient cells were infected at a low multiplicity of infection (moi < 1) and finally sorted on a BD FACSAria III SORP cell sorter.
After 3 days confinement, the HS27A-Turquoise and ML2-Cherry cells were analyzed using the BD LSRFortessa cell analyzer.
After 3 days confinement, the HS27A-Turquoise and ML2-Cherry cells were analyzed using the BD LSRFortessa cell analyzer.
9
Generating Isogenic CRISPR Knockout Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral constructs expressing CRISPR-associated protein 9 (Cas9) and guide RNAs (gRNAs) originally generated from Feng Zhang’s lab22 (link) were obtained from Addgene (Cambridge, MA). We first established the HMCLs stably expressing Cas9 by infection of HMCLs with lentivirus-expressing Cas923 (link). A total of four gRNAs targeting CD147 and CRBN, were selected from CRISPR pooled libraries generated from Dr. Fang Zhang’s and Dr. Jason Moffat’s labs, including: CD147 #3 TTCACTACCGTAGAAGACCT; CD147 #5 TGGAGCTGGTTGCCGTTGCAC; CD147 #6 CGTCAGAACACATCAACGAG; CRBN #2 CCTTTGCTGTTCTTGCATAC. They were synthesized and cloned into the BbsI-digested plasmid containing the entire guide RNA scaffold. Lentivirus harboring non-targeting vector (Vec) and all gRNA expression constructs were generated and used to infect HMCLs. At day 3 after infection, puromycin was added to the media (5 μg/ml) in order to select infected cells. At days 7–14 after infection, cells infected with virus expressing CD147 gRNAs were stained with anti-CD147 antibody, followed by sorting of CD147-negative cells (BD Biosciences FACS Aria III SORP Cell Sorter). The expression of CD147 in sorted cells was further evaluated by immunoblotting assay. For CRBN gRNA-transduced cells, the single clone that had no CRBN expression (validated by immunoblotting assay) was selected and expanded.
10
Isolation and Expansion of ILC2s from Murine Lungs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Naive WT mice were intratracheally administered 500 ng/50 μL of IL-33 (R&D Systems) in PBS on days 0 and 2 and humanely killed on day 4 to isolate lung single cell suspensions as described above. Cells were depleted of Lin+ cells by magnetic bead separation according to the manufacturer’s recommendations (Miltenyi Biotec, San Diego, Calif). The lineage-depleted population was sorted by flow cytometry for ILC2s (Lin−CD45+CD90.2+Sca-1+ST2+) on a BD Biosciences FACS Aria III SORP Cell Sorter. The purity of sorted ILC2s was >99%. ILC2s were cultured in complete RPMI 1640 with IL-2 (10 ng/mL), IL-7 (10 ng/mL), IL-25 (10 ng/mL), and IL-33 (5 ng/mL) (R&D Systems) to expand and maintain ILC2s for 8–10 days. Before coculture, ILC2s were rested in IL-2 (10 ng/mL) and IL-7 (10 ng/mL) for 24 hours, followed by 24 hours of IL-7 (10 ng/mL), as previously described.45 (link) This resulted in reduced proliferation, activation (eg, IL-5 and IL-13 production), and smaller cell morphology while maintaining >95% viability. Cells were washed 3 times in complete RPMI 1640 media to remove cytokines before coculture experiments with eosinophils. More details are available in Fig E2 , in Fig E3 , A , and in the Methods in the Online Repository at www.jacionline.org .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!