Bamhi and noti

A PEX6 (NM_000287.4) pcDNA3.1+/C-(K)-DYK expression plasmid was obtained (GenScript) and transformed DH5α-competent Escherichia coli cells (Thermo Scientific). To create a PEX6 c.35T→C version of the same expression plasmid, we used a mutagenic forward primer (5′-GATCGGATCCTTATGGCGGTCGCTGTCTTGCGGGTCCTGGAGCCCTCTCCGACCGAG -3′) that incorporated the base pair change (underlined) as well as a BamHI restriction site. The reverse primer (5′-GATCGCGGCCGCCTAGCAGGCAGCAAACTTGCGC-3′) included a NotI restriction site. After polymerase chain reaction amplification using the plasmid as a template, the product and recipient plasmid was subject to restriction digestion reaction with BamHI and NotI (Thermo Scientific) and ligated at a 3:1 molar ratio of insert to plasmid, generating the PEX6 c.35T→C pcDNA3.1+/C-(K)-DYK expression plasmid. Successful cloning was confirmed by restriction digestion and Sanger sequencing.
Commercially available peroxisomal targeting signal 1 (PTS1) expression plasmid pEGFP-C1+SKL (Addgene) was obtained for the in vitro PTS1-mediated protein import assay. The in vitro green fluorescent protein signal was assessed with the EVOS M5000 Imaging System (Thermo Scientific).

The RNA of S. miltiorrhiza root was extracted using cetyltrimethylammonium bromide (CTAB) solution (2% [w/v] CTAB, 2% [w/v] PVP, 100 mM Tris–HCl, 25 mM EDTA, 2M NaCl, and 2% β-mercaptoethanol) (Fang et al., 2017 (link)). Taking 1 μg of RNA of sample above performed reverse transcript following instruction of cDNA Synthesis Kit (TOYOBO, Osaka, Japan). The primers (Supplemental Table S4) were designed for amplifying 2-ODD sequences using KOD DNA polymerase (TOYOBO).
After digesting by Bam HI and Not I (Thermo Scientific, Waltham, MA, USA), the PCR amplicon of coding sequence was cloned into vector pET32a, and the pET32a-2ODD vectors were introduced into E. coli Rosetta 2 (DE3). The protein expression was induced by β-d-1-thiogalactopyranoside. After harvesting the cultures, crude protein lysate was centrifuged and purified with affinity chromatography with nickel nitrilotriacetic acid resin (Thermo Scientific), and the protein concentration was determined with bovine serum albumin standard.