Log In Sign up
The largest database of trusted experimental protocols

Fam labeled probe

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

FAM-labeled probes are fluorescent DNA or RNA oligonucleotides that are labeled with the fluorescent dye FAM (6-carboxyfluorescein). These probes are designed to hybridize to a specific target sequence and emit fluorescence upon binding, which can be detected and quantified.

Automatically generated - may contain errors

Lab products found in correlation

7500 fast real time pcr system, by Thermo Fisher Scientific (6 mentions) Maxima first strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (4 mentions) Rneasy kit, by Qiagen (4 mentions) Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions) Trizol reagent, by Thermo Fisher Scientific (3 mentions) Taqman universal pcr master mix, by Thermo Fisher Scientific (3 mentions) Taqman pcr master mix, by Thermo Fisher Scientific (3 mentions) Oligo dt 20 primer, by Thermo Fisher Scientific (2 mentions) Itaq universal syber green supermix, by Bio-Rad (2 mentions) Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (2 mentions) Rneasy mini kit, by Qiagen (2 mentions) C1000 thermal cycler, by Bio-Rad (2 mentions) Myq icycler, by Bio-Rad (2 mentions) Iscript gdna clear cdna synthesis kit, by Bio-Rad (2 mentions) Rnaeasy kit, by Qiagen (2 mentions) Vic labeled probes for 18s, by Thermo Fisher Scientific (2 mentions) Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions) Direct zol rna miniprep, by Zymo Research (1 mentions) Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)

23 protocols using fam labeled probe

1

Tissue RNA Isolation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tissue and cells were lysed in TRIzol reagent (15596018, Thermo Fisher Scientific). Total RNA was isolated using Direct-zol RNA MiniPrep (Zymo Research) or manual isolation according to the manufacturer’s instructions. RNA was quantified using NanoDrop ND-1000 Spectrophotometer and RNA (500 ng) was then reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). TaqMan® qPCR experiments were performed in 384-well plates and run with the QuantuStudio System using the default cycling method (50°C for 2 minutes, 95°C for 10 minutes followed by 40 cycles at 95°C for 15 seconds and 60°C for 1 minutes) provided by the software. The reaction volume in each well was 5 μl and the mixture included 1X assay probe (containing specific primers and probes, Table 1), 1X TaqMan® universal master mix (containing PCR buffer, nucleotides and taq DNA polymerase) and cDNA template (12 ng). Data analysis was performed using the software qPCR Data Analysis, data were expressed as Ct values and used for the relative quantification of targets with the ΔΔCt calculation to give N-fold differences. Data were transformed through the equation 2−ΔΔCt. Gene-specific primers with FAM-labeled probes were from Thermo Fisher Scientific are reported in Table S4.
Morozzi G., Rothen J., Toussaint G., De Lange K., Westritschnig K., Doelemeyer A., Ueberschlag V.P., Kahle P., Lambert C., Obrecht M., Beckmann N., Ritter V., Panesar M., Stauffer D., Garnier I., Mueller M., Guerini D., Keller C.G., Knehr J., Roma G., Bidinosti M., Brachat S., Morvan F, & Fornaro M. (2021). STING regulates peripheral nerve regeneration and colony stimulating factor 1 receptor (CSF1R) processing in microglia. iScience, 24(12), 103434.
+ Open protocol
+ Expand
2

Quantitative Analysis of C3 mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from 2 × 106 cells using RNeasy Kit (Qiagen) and 1 μg reverse transcribed to cDNA by Superscript III (Thermo Scientific). C3 mRNA levels were quantified by real-time PCR using primers and FAM-labeled probes from Thermo Scientific (#Hs00163811_m1), according to the manufacturer's instructions. Data were normalized to the housekeeping hypoxanthine guanine phosphoribosyl transferase (HPRT) gene (#Hs99999909_m1) and expression calculated with the 2-dCt method. PCR was performed using the ViiA7 real-time PCR system (Thermo Scientific). The presence of full-length human C3 in the Raji B cell line and blood B cells was analyzed via conventional PCR using Phusion DNA polymerase (Thermo Scientific) and the following forward (Fw) and reverse (Rv) primers (numbered from canonical ATG start codon): Fw_27 GCTGCTCCTGCTACTAACCC, Fw_2822 CTGTGGCTGTTCGCACCCT, Rv_2918 CTGGTCTCAGACTCGGTGT, Rv_3818 CAAGGCTTGGAACACCATGA and Rv_4973 CATTCTCGAGTCAGTTGGGGCACCCAAAGA. As a positive control, cDNA prepared from total liver tissue RNA (Thermo Scientific) was used. The reaction consisted of incubation at 98°C for 2 min followed by 35 cycles of 98°C for 10 s, 60°C for 15 s and 72°C for 2 min. The amplified products were separated by electrophoresis on a 1% agarose gel containing the SyberSafe DNA dye (Thermo Scientific).
Kremlitzka M., Nowacka A.A., Mohlin F.C., Bompada P., De Marinis Y, & Blom A.M. (2019). Interaction of Serum-Derived and Internalized C3 With DNA in Human B Cells—A Potential Involvement in Regulation of Gene Transcription. Frontiers in Immunology, 10, 493.
+ Open protocol
+ Expand
3

Validating Differential Gene Expression in PCOS

Check if the same lab product or an alternative is used in the 5 most similar protocols
cDNA was synthesized from 500 ng of RNA (n = 34) using a first strand cDNA synthesis kit (Takara Bio USA Inc.). Transcript levels of DMGs selected for validation (Additional file 4) were assayed by TaqMan chemistry using the TaqMan™ Universal Master Mix II with UNG, and FAM-labeled probes (ThermoFisher Scientific, MA, USA). Assay containing VIC-labeled 18s rRNA probe was used as the housekeeping control. qPCR was carried out using cDNA dilutions ranging between neat to 1:100. Fold change in gene expression between controls and PCOS was evaluated using the 2-ΔΔCt method, where the expression was normalized to 18s levels, using a CGC calibrator sample.
Sagvekar P., Kumar P., Mangoli V., Desai S, & Mukherjee S. (2019). DNA methylome profiling of granulosa cells reveals altered methylation in genes regulating vital ovarian functions in polycystic ovary syndrome. Clinical Epigenetics, 11, 61.
+ Open protocol
+ Expand
4

Quantitative Analysis of RNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from cell pellets or murine splenocytes (see below) using the RNeasy Mini Kit (Qiagen) and the manufacturer’s instructions. For murine splenocytes and HEK293T cells, cDNA was made from RNA using Maxima First Strand cDNA Synthesis Kit (ThermoFIsher Scientific). Real-Time PCR was preformed on the cDNA using iTaq Universal Syber Green Supermix (Bio-Rad) using the BioRad C1000 Thermal Cycler (Supplementary Table 2). For Primary PBMCs, cDNA was generated using Superscript III Reverse transcriptase and Oligo(dT)20 Primer (Invitrogen). TaqMan multiplex real-time PCR was performed for expression of human IFN-β and IFIH1 transcripts using FAM-labeled probes (Thermo-Fisher) Hs01077958_s1 (IFNB1) and Hs0170332_m1 (IFIH1). Transcript levels of RNA polymerase II were determined as endogenous control using VIC-labeled probe Hs001722187_m1. PCR reactions were run on a 7500 Fast Real-Time PCR system (Applied Biosystems).
Gorman J.A., Hundhausen C., Errett J.S., Stone A.E., Allenspach E.J., Ge Y., Arkatkar T., Clough C., Dai X., Khim S., Pestal K., Liggitt D., Cerosaletti K., Stetson D.B., James R.G., Oukka M., Concannon P., Gale M J.r., Buckner J.H, & Rawlings D.J. (2017). The A946T variant IFIH1 RNA sensor mediates an interferon program that limits viral infection but increases the risk for autoimmunity. Nature immunology, 18(7), 744-752.
+ Open protocol
+ Expand
5

Quantitative Analysis of RNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from cell pellets or murine splenocytes (see below) using the RNeasy Mini Kit (Qiagen) and the manufacturer’s instructions. For murine splenocytes and HEK293T cells, cDNA was made from RNA using Maxima First Strand cDNA Synthesis Kit (ThermoFIsher Scientific). Real-Time PCR was preformed on the cDNA using iTaq Universal Syber Green Supermix (Bio-Rad) using the BioRad C1000 Thermal Cycler (Supplementary Table 2). For Primary PBMCs, cDNA was generated using Superscript III Reverse transcriptase and Oligo(dT)20 Primer (Invitrogen). TaqMan multiplex real-time PCR was performed for expression of human IFN-β and IFIH1 transcripts using FAM-labeled probes (Thermo-Fisher) Hs01077958_s1 (IFNB1) and Hs0170332_m1 (IFIH1). Transcript levels of RNA polymerase II were determined as endogenous control using VIC-labeled probe Hs001722187_m1. PCR reactions were run on a 7500 Fast Real-Time PCR system (Applied Biosystems).
Gorman J.A., Hundhausen C., Errett J.S., Stone A.E., Allenspach E.J., Ge Y., Arkatkar T., Clough C., Dai X., Khim S., Pestal K., Liggitt D., Cerosaletti K., Stetson D.B., James R.G., Oukka M., Concannon P., Gale M J.r., Buckner J.H, & Rawlings D.J. (2017). The A946T variant IFIH1 RNA sensor mediates an interferon program that limits viral infection but increases the risk for autoimmunity. Nature immunology, 18(7), 744-752.
+ Open protocol
+ Expand
6

Quantifying Mitochondrial DNA in Brown Fat

Check if the same lab product or an alternative is used in the 5 most similar protocols
Relative mitochondrial DNA content of brown adipose tissue was determined using a modified protocol by Humble M et al. 2012 (new reference 26 (link)). Briefly, BAT was lysed in 200μl of 25mM NaOH per 15mg of tissue for 2 hours at 98°C, then neutralized with 20 μl of 1M Tris pH 8. Tissue lysates were subjected to PCR using the following cycling protocol: 95°C for 10 min, and 40 cycles at 95°C for 15s and 60°C for 1 min. All reactions were performed in duplicate and 2 μl of a diluted (1:100) lysate was used in a 25 μl reaction with TaqMan 2X Universal Mix (Applied Biosystems, Foster City, CA). FAM-labeled probes targeting the mitochondrial-specific gene Nd1(Applied Biosystems) and nuclear Actin (Applied Biosystems) were added to separate reactions. PCR was carried out on a BioRad MyQ iCycler to generate Ct values for each reaction. Relative mitochondrial DNA content was determined by the ratio of Nd1 to Actin Ct values for a given lysate.
Chrysovergis K., Wang X., Kosak J., Lee S.H., Kim J.S., Foley J.F., Travlos G., Singh S., Baek S.J, & Eling T.E. (2014). NAG-1/GDF15 prevents obesity by increasing thermogenesis, lipolysis and oxidative metabolism. International journal of obesity (2005), 38(12), 1555-1564.
+ Open protocol
+ Expand
7

Quantitative PCR Analysis of Muscle Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from quadriceps and LA/BC muscles with TRIzol Reagent (Life Technologies) according to the manufacturer’s instructions. RNA (1 μg) was reverse transcribed to cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Gene-specific primers with FAM-labeled probes were from Applied Biosystems: Nr4a1, Mm01300401_m1; Prkar2a, Mm00435916_m1; Prkag3, Mm00463997_m1; Hk2, Mm00443385_m1; Slc2a4, Mm01245502_m1; Phkg1, Mm02580948_m1; Pygm, Mm00478582_m1; Ppargc1a, Mm01208835_m1; Ppargc1b, Mm00504720_m1; Bbc3, Mm00519268_m1. AR-specific forward primer 5’-CCAGTCCCAATTGTGTCAAA-3’ and reverse primer 5’-TCCCTGGTACTGTCCAAACG-3’ (Life Technologies) were used with Roche Universal Probe Library FAM-labeled probe #58 (cat.no. 04688554001). Cpsf2-specific primers with VIC-labeled probes (Applied Biosystems; Mm00489754_m1) were used as internal control. Quantitative PCR (qPCR) was carried out using FastStart TaqMan Probe Master Mix (Roche) on software supplied with a 7500 Real-Time PCR SDS System (Applied Biosystems). PCR cycling conditions were as follows: 50°C for 2 min, 95°C for 10 min, 40 cycles at 95°C for 15 s and 60°C for 1min.
Giorgetti E., Yu Z., Chua J.P., Shimamura R., Zhao L., Zhu F., Venneti S., Pennuto M., Guan Y., Hung G, & Lieberman A.P. (2016). Rescue of metabolic alterations in AR113Q skeletal muscle by peripheral androgen receptor gene silencing. Cell reports, 17(1), 125-136.
+ Open protocol
+ Expand
8

Quantitative Real-Time PCR Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
It was performed using the ABI-Prism7700 sequence detection system (Applied Biosystems) as described earlier [28] (link), [29] using primers and FAM-labeled probes from Applied Biosystems. The mRNA expressions of respective genes were normalized to the level of GAPDH mRNA. Data were processed by the ABI Sequence Detection System 1.6 software and analyzed by ANOVA.
Roy A., Modi K.K., Khasnavis S., Ghosh S., Watson R, & Pahan K. (2014). Enhancement of Morphological Plasticity in Hippocampal Neurons by a Physically Modified Saline via Phosphatidylinositol-3 Kinase. PLoS ONE, 9(7), e101883.
+ Open protocol
+ Expand
9

Quantifying Gene Expression in R28 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from R28 cells with RNeasy Plus mini kit (Qiagen) according to the manufacturer’s protocol. Total RNAs were reverse transcribed into cDNA using iScript cDNA Synthesis Kit (Bio-Rad). Duplex qRT-PCRs were carried out using 1 μl of RT reaction, Taqman universal PCR master mix (Applied Biosystems), gene-specific primers with FAM-labeled probes (Applied Biosystems) as listed in Table S1, along with β-actin primers with VIC-labeled probe (primer limited formulation, Applied Biosystems). Reactions were performed and monitored using a CFX384 real time PCR system (Bio-Rad). Normalized relative gene expressions were calculated using the ΔΔCt method.
Kong D., Gong L., Arnold E., Shanmugam S., Fort P.E., Gardner T.W, & Abcouwer S.F. (2016). Insulin-like Growth Factor 1 Rescues R28 Retinal Neurons from Apoptotic Death through ERK-mediated BimEL Phosphorylation Independent of Akt. Experimental eye research, 151, 82-95.
+ Open protocol
+ Expand
10

Gene Expression Analysis in Rat Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using Quick-RNA™ Miniprep Kit (Zymo Research, Irvine, CA, USA, R1055). Column purified, total RNA was reverse transcribed to complementary DNA using a Verso complementary DNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA, AB-1453/B). Reverse-transcribed RNA was analyzed by Applied Biosystems™ 7500 Real-Time PCR (Thermo Fisher Scientific, Waltham, MA, USA) using the real-time PCR that was performed using the TaqMan-Master mix and TaqMan gene expression assays with FAM-labeled probes using standard amplification protocol (Applied Biosystems). Rat primers for tumor necrosis factor (Tnf; Rn01525859_g1), interleukin 6 (Il6; Rn01410330_m1), interleukin 1 beta (Il1β; Rn00580432_m1), and Gapdh (Rn01775763_g1) were purchased from Thermo Fisher Scientific, Waltham, MA, USA. Gapdh was used as an internal control for normalization. Experiments were carried out in triplicate. The fold change in expression was then obtained by the 2−ΔΔCT method.
Tripathi A., Thangaraj A., Chivero E.T., Periyasamy P., Burkovetskaya M.E., Niu F., Guo M.L, & Buch S. (2020). N-Acetylcysteine Reverses Antiretroviral-Mediated Microglial Activation by Attenuating Autophagy-Lysosomal Dysfunction. Frontiers in Neurology, 11, 840.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!