RNA from human cell lines and colonic tissues and tumors was isolated using Trizol reagent (Invitrogen) according to manufacturer guidelines. Tissues and tumor pieces were shredded using a homogenizer (T10 basic ULTRA-TURRAX). After reverse transcription (M-MuLV Reverse Transcriptase from NEB) of equal amounts of mRNA, quantitative real-time PCR analysis was performed using a qPCR MasterMix (72 mM Tris-HCl pH 8.8 (Roth), 19 mM (NH4)2SO4 (Roth), 0.01% Tween-20 (AppliChem), 3 mM MgCl2, (Sigma-Aldrich), 1:80,000 SYBR Green (Invitrogen), 0.24 mM dNTPs, (dATP, dCTP, dGTP, dTTP, all dNTPs from Primetech), 19 U/ml Taq-polymerase (Primetech), 0.24% Triton X-100 (AppliChem), 300 mM Trehalose (Roth). Used primers are listed in Supplemental Table 1 . For gene analysis, at least two different cDNAs (technical replicates) were used for qRT-PCR runs from one biological replicate. Biological replicates are independent experiments.
Nh4 2so4
Manufactured by Carl Roth
Sourced in Germany, United States
Ammonium sulfate, (NH4)2SO4, is a white crystalline chemical compound that is commonly used as a laboratory reagent and in various industrial applications. It serves as a source of ammonium ions and sulfate ions, which are essential for various chemical processes and analyses.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green, by Thermo Fisher Scientific (2 mentions)
Mgcl2, by Merck Group (2 mentions)
Triton x 100, by AppliChem (2 mentions)
Tween 20, by AppliChem (2 mentions)
Tris hcl ph 8, by Carl Roth (2 mentions)
Trehalose, by Carl Roth (2 mentions)
M mulv reverse transcriptase, by New England Biolabs (2 mentions)
D glucose, by Merck Group (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Qpcr master mix, by Carl Roth (1 mentions)
Trehalose, by Merck Group (1 mentions)
Phenylmethylsulfonyl fluoride pmsf, by Merck Group (1 mentions)
Ficoll 70, by Merck Group (1 mentions)
1 6 hexanediol, by Merck Group (1 mentions)
Phosphate buffered saline (pbs), by AppliChem (1 mentions)
Nicotinamide adenine dinucleotide, by Merck Group (1 mentions)
Feso4 7h2o, by Merck Group (1 mentions)
Kh2po4, by Carl Roth (1 mentions)
Pyruvic acid, by Carl Roth (1 mentions)
Hydroxyectoine, by Merck Group (1 mentions)
6 protocols using nh4 2so4
1
Quantitative RT-PCR Analysis of Gene Expression
2
Protein Purification Buffers and Additives
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All buffers were prepared at room temperature. The lysis buffer contained 20 mM Na2HPO4 and 150 mM NaCl, pH 7.0. Buffer A contained 30 mM Na2HPO4, 500 mM NaCl, 5% (v/v) glycerol, and 0.5 mM DTT, pH 7.0. Buffer B contained 30 mM Na2HPO4, 150 mM NaCl, and 5% (v/v) glycerol. Buffer C contained 30 mM Na2HPO4, 300 mM NaCl, and 5% (v/v) glycerol, pH 7.0. Buffer D contained 30 mM Na2HPO4, 300 mM NaCl, and 1% (v/v) glycerol, pH 7.0. Buffer E contained 20 mM Tris–HCl, 150 mM NaCl, and 5% (v/v) glycerol, pH 7.0. Buffer IEX_A contained 30 mM Na2HPO4, 20 mM NaCl, 5% (v/v) glycerol, and 0.5 mM DTT, pH 7.0. Buffer IEX_B contained 30 mM Na2HPO4, 1 M NaCl, 5% (v/v) glycerol, and 0.5 mM DTT, pH 7.0. PEGs, TMAO, 1,6-hexanediol, Ficoll 70, trehalose, and phenylmethylsulfonyl fluoride (PMSF) were purchased from Sigma–Aldrich, and (NH4)2SO4 was purchased from Carl Roth.
3
Preparation of Antibiotic Broth Medium
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibiotic broth medium No. 3 (complex medium) was purchased from Oxoid LTD (Hampshire, Great Britain). Pyruvic acid, sucrose, KH2PO4, KOH, and (NH4)2SO4 were purchased from Roth (Karlsruhe, Germany). D -glucose, MgSO4·7 H2O, and FeSO4·7 H2O were obtained from Merck (Darmstadt, Germany). Trehalose and NaCl were purchased from Fluka (Buchs, Schwitzerland). Ectoine (≥99%) for lactate deydrogenase stress experiments was purchased from bitop AG (Witten, Germany). HydroxyEctoine (≥99%) for lactate dehydrogenase (LDH) stress experiments was isolated from H. elongata strain DSM 2581T in our laboratories. Freeze-dried LDH (rabbit muscle) and nicotinamide adenine dinucleotide were purchased from Sigma (Steinheim, Germany). Phosphate buffered saline (PBS) was purchased from AppliChem (Darmstadt, Germany). Ectoine (≥99.0%) and hydroxyEctoine (≥98%) for spin lable and Fourier transform infrared (FTIR) experiments were purchased from Sigma (USA). Perdeuterated spin probe Tempone-d16 (4-Oxo-2,2,6,6-tetramethylpiperidine-d16-1-oxyl; Figure 7 inset) was a kind gift of Prof. I. Grigoriev (Institute of Organic Chemistry of the Russian Academy of Sciences, Novosibirsk, Russia).
4
Fungal Metabolomics Sample Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For conditioning the fungus for metabolomics experiments, a 6 mm diameter mycelia-covered agar plug of the actively growing colony margin was transferred to the center of a fresh petri dish (94 mm × 16 mm, Greiner Bio-One GmbH, Kremsmünster, Austria) containing minimal medium (0.52 g L−1 KCl (Roth); 0.52 g L−1 MgSO4 × 7(H2O) (Roth); 1.52 g L−1 KH2PO4 (Fluka) 0.0004 g L−1 Na2B4O7 × 10(H2O) (Roth); 0.004 g L−1 CuSO4 × 5(H2O) (Sigma-Aldrich, Burlington, MA, USA); 0.008 g L−1 FeSO4 × 7(H2O) (Roth); 0.008 g L−1 MnSO4 × 4(H2O) (Sigma-Aldrich, Burlington, MA, USA); 0.005 g L−1 Na2MoO4 × 7(H2O) Sigma-Aldrich, Burlington, MA, USA); 0.08 g L−1 ZnSO4 × 7(H2O) (Roth); 2.64 g L−1 (NH4)2SO4 (Roth); 1.6% Agarose (NEEO ultra-quality; Roth, Karlsruhe, Germany) pH 5.5). Moreover, 10 g L−1 native or labeled glucose was used as a sole carbon source. For cultivation on native (12C) glucose, D (+)-glucose (≥99.5% purity; Sigma-Aldrich, Burlington, MA, USA) was used. For the global labeling of the metabolome, the fungus was cultivated on 13C6 glucose (U-13C6 D (+)-glucose; 99.9%; Cambridge Isotope Laboratories, Inc., Woburn, MA, USA). Cultures were incubated for 3 days at 25 °C.
5
qRT-PCR Analysis of Organoid Cultures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For qRT-PCR analysis, organoids were cultured and treated in 12-well plates. mRNA was isolated using TRIzol. After mRNA quantification with a microvolume spectrophotometer (Nanodrop 1000 Spectrophotometer, Peqlab) and reverse transcription of 1 µg RNA (M-MuLV Reverse Transcriptase, NEB), the qRT-PCR analysis was performed using 75 mM Tris-HCl pH 8.8 (Roth), 20 mM (NH4)2SO4 (Roth), 0.01% Tween-20 (AppliChem), 3 mM MgCl2 (Sigma-Aldrich), 0.25% Triton X-100 (AppliChem), 0.2 mM dNTPs (Primetech), 20 U/ml Taq-polymerase (Primetech), 300 mM Trehalose (Roth) and SYBR Green (Invitrogen). Primers are listed in Table 2 and were used in a two-step protocol (2 min at 95°C pre-heating; 40 cycles at 95°C for 15 s followed by 60°C for 1 min). Each qRT-PCR was run as two in-plate replicates with additional no-template controls to exclude contaminations. Mean Ct-values of in-plate replicates were normalized to mean Ct-values of the housekeeping gene Rplp0 (36B4). Relative values are presented as ratio (2−ddCT) with reference to the untreated control.
Primers used in this study.
| Gene | Primer forward | Primer reverse |
|---|---|---|
| Rplp0 | 5‘−GCAGATCGGGTACCCAACTGTTG | 5‘−CAGCAGCCGCAAATGCAGATG |
| Ccnd1 | 5‘−GGAGCTGCTGCAAATGGAAC | 5‘−CAGTCCGGGTCACACTTGA |
| E2f1 | 5‘−AACTGGGCAGCTGAGGTGC | 5‘−CAAGCCGCTTACCAATCCC |
| Pcna | 5‘−AGTGGAGAGCTTGGCAATGG | 5‘−TCAGGTACCTCAGAGCAAACG |
6
Purification of Key Cytoskeletal Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fibronectin was purified from human plasma by gel filtration and affinity chromatography over a Sepharose CL-4B column (Sigma), followed by a gelatin Sepharose column from GE Healthcare (Munich, Germany). Subsequently, fibronectin was eluted by 6 M urea (Sigma) in PBS and dialyzed against PBS before use.
Actin was isolated from an acetone powder of rabbit skeletal muscle in G-buffer by modifying the protocol of Spudich and Watt. 35 Actin was polymerized by adding 50 mM KCl and 2 mM MgCl 2 (Carl Roth). Subsequently, KCl and MgCl 2 were removed by dialyzation with G-buffer, and the depolymerized actin was purified by gel filtration with a Superdex 200 column (GE Healthcare) and stored in G-buffer. According to the protocol of Margossian and Lowey we also isolated myosin II from rabbit skeletal muscle using centrifugation and salting out. 36 The purified myosin was diluted in D-buffer. a-Actinin was isolated from chicken gizzard following the protocol of Craig et al. 37 After extraction with 1 mM KHCO 3 a-actinin was salted out with (NH 4 ) 2 SO 4 (Carl Roth) and purified with ion exchange chromatography over a DEAE column (GE Healthcare) and gel filtration with a Superdex 200 column. Isolated a-actinin was stored in A-buffer.
Actin was isolated from an acetone powder of rabbit skeletal muscle in G-buffer by modifying the protocol of Spudich and Watt. 35 Actin was polymerized by adding 50 mM KCl and 2 mM MgCl 2 (Carl Roth). Subsequently, KCl and MgCl 2 were removed by dialyzation with G-buffer, and the depolymerized actin was purified by gel filtration with a Superdex 200 column (GE Healthcare) and stored in G-buffer. According to the protocol of Margossian and Lowey we also isolated myosin II from rabbit skeletal muscle using centrifugation and salting out. 36 The purified myosin was diluted in D-buffer. a-Actinin was isolated from chicken gizzard following the protocol of Craig et al. 37 After extraction with 1 mM KHCO 3 a-actinin was salted out with (NH 4 ) 2 SO 4 (Carl Roth) and purified with ion exchange chromatography over a DEAE column (GE Healthcare) and gel filtration with a Superdex 200 column. Isolated a-actinin was stored in A-buffer.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!