Zsgreen1 reporter

The cell lines, PNT2, Du145, and PC-3 from ATCC, were maintained in RPMI 1640 (Gibco, 11875-085) supplemented with 10% FBS (Gibco). siRNA-mediated cell silencing was done using Lipofectamine 2000 or RNAiMAX reagents (Life Technologies) using 1 to 1000 of the transfection reagent and 10 nM siRNA (final conc.). siRNAs were ON-TARGETplus siRNAs from Dharmacon. siRNAs used for experiments other than RNAi screen were the following: siCAV1:GAGCUUCCUGAUUGAGAUUdTdT; siCAV1_2: AAGAGCTTCCTGATTGAGATT; siCTRL: ON-TARGETplus Non-targeting siRNA #1 and #2; siITGB1: J-004506-05, J-004506-06, J-004506-07, J-004506-08; ITGA2: J-004566-06, J-004566-08; siITGA5: J-008003-08; siITGA6: J-007214-06; siKIND-2: J-012753-05; siFOSL1: J-004341-06, J-004341-07, J-004341-08), where the code is the dublex catalog number for Dharmacon siRNAs. Alternatively, CAV1 was silenced using a lentiviral system (L-shCAV1), where target sequence corresponded to human CAV1 nucleotides 254–277 (‘5-GACGTGGTCAAGATTGACTTT-3’). This sequence was cloned into pLVX-shRNA2, which contains a ZsGreen1 reporter (Clontech, Mountain View, CA). The use of this construct has been well-documented^{63 (link),64 (link)}. Lentiviral infection was performed as in^{63 (link)}. The siRNA sequences used in the siRNA screen can be found in the Supplementary Table S8. The RNAi screen methodology was done as described in^{65 (link)}.

MCs (1.2 × 10⁵) were seeded on 24-well plates 24 h prior transfection. Cells were transfected overnight with 80 pmol of siRNA corresponding to human Cav1 bases 403–423 (target sequence: AAGAGCTTCCTGATTGAGATT) or the same amount of control siRNA in 400 μl antibiotic-free medium containing 1 μl Dharmafect 1 (Dharmacon, Lafayette, CO) (Beardsley et al, 2005 (link)). Transfections were repeated after 48 h. 72 h after the last transfection, knockdown efficiency was determined by Western blot and cells were processed as indicated. An alternative Cav1 siRNA was designed (5′-GACGTGGTCAAGATTGACTTT-3′) corresponding to human Cav1 bases 254–277. This sequence was cloned into pLVX-shRNA2, which contains a ZsGreen1 reporter (Clontech, Mountain View, CA). Lentiviral infection was performed as in Goetz et al (2011 (link)). MCs were also infected with pRR-CMV-Cav-IRES-GFP with pLVX-Cav-ZsGreen, or with empty vectors as a control.