The largest database of trusted experimental protocols

Mir 320b inhibitors

Manufactured by RiboBio
Sourced in China

MiR‐320b inhibitors are small, synthetic molecules designed to specifically target and inhibit the expression of the miR‐320b microRNA. MiR‐320b is a non-coding RNA molecule involved in the regulation of gene expression. The MiR‐320b inhibitors provide a tool for researchers to study the biological functions and mechanisms of miR‐320b in various experimental systems.

Automatically generated - may contain errors

2 protocols using mir 320b inhibitors

1

Transfection of ZEB1-AS1, BMPR1A, and miR-320b

Check if the same lab product or an alternative is used in the 5 most similar protocols
The overexpressing vector for ZEB1‐AS1 (pcDNA3.1‐ZEB1‐AS1), siRNA targeting ZEB1‐AS1 (sh‐ZEB1‐AS1), and siRNA targeting BMPR1A (sh‐BMPR1A), as well as negative control vectors, were synthesized by GenePharma (Shanghai, China). miRNAs including miR‐320b mimics, miR‐320b inhibitors, and negative controls (mimics NC, inhibitors NC) were bought from RiboBio (Guangzhou, China). For transfection, the cells were transfected with pcDNA3.1‐ZEB1‐AS1, sh‐ZEB1‐AS1, miR‐320b mimics, miR‐320b inhibitors, sh‐BMPR1A, or their corresponding negative controls using Lipo6000 reagent (Beyotime Biotechnology, China) for 48 h.
+ Open protocol
+ Expand
2

Knockdown of lncRNA DLEU1 in CRC cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
CRC cell lines (LoVo, SW620, HCT116 and SW480) and normal cells HIEC were obtained from Cobioer (Nanjing, China) and followed their instructions to culture at 37°C. Sh-LncRNA DLEU1(sequence: CAACGGAAUGUAUCAAUGATT), sh-PRPS1(sequence: GCAGCTCCCACCAGGACTTAT), sh-NC(sequence: TTCTCCGAACGTGTCACGT), miR-320b mimics(sequence: AAAAGCUGGGUUGAGAGGGCAA), NC mimics(sequence: UUCUCCGAACGUGUCACGUTT), miR-320b inhibitors(sequence: UUGCCCUCUCAACCCAGCUUUU) and NC inhibitors(sequence: CAGUACUUUUGUGUAGUACAA) were obtained from RIBOBIO (Guangzhou, China). Cell transfection was conducted following the instruction of Lipofectamine 2000 (Invitrogen, CA, USA). Stably DLEU1-knockdown cell lines were screened out as previously reported (20 (link)). In brief, oligonucleotide for small hairpin RNA (shRNA) targeting DLEU1 was synthesized and inserted into the shRNA vector pGPH1/Neo (GenePharma, Shanghai, China). The DLEU1 shRNA vector was transfected into LoVo and SW480 cells with Lipofectamine 3000 (Invitrogen, CA, USA) and selected for 4 weeks with neomycin (1000 μg/ml). Scrambled shRNA (sh-NC) was applied as control. After culturing for 48 h, cells were utilized for follow-up study.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!