Trizol reagent kit

Total RNA from cultured cells was extracted using a Trizol reagent kit (Takara, Dalian, China), and qRT-PCR was performed as described previously (17 (link)). GAPDH was used as an internal control. The primer sequences were as follows: 5’-GCGGAGGCTACGAATACTCG-3’ (forward), 5’-TCTAGGTCGATGTACTTGGCAG-3’ (reverse), GAPDH: 5’-GGAGCGAGATCCCTCCAAAAT-3’ (forward), 5’-GGCTGTTGTCATACTTCTCATGG-3’ (reverse).

Total RNAs of liver tissue were extracted using the TRIzol reagent kit (TaKaRa, Dalian, China). RNA was reverse transcribed using a cDNA kit (TaKaRa, Dalian, China) according to the manufacturer’s instructions. qRT-PCR was conducted using a 20 µL reaction sample with SYBR GREEN II (TaKaRa, Dalian, China) and the iCycleriQ multicolor real-time PCR detection system (Bio-Rad, Hercules, CA, USA). Gene expression was normalized using β-actin as an internal control. The primer sequences for peroxisome proliferator-activated receptor alpha (PPARα), peroxisome proliferator-activated receptor gamma (PPARγ), sterol regulatory element binding protein (SREBP), recombinant fatty acid synthase (FASN), and acetyl-CoA carboxylase (ACC) for qRT-PCR are shown in Table 1. The target genes were normalized by 2^−ΔΔCt results and expressed as relative gene expression levels [26 (link),27 (link)].

GuangZao and RouDouKou were purchased from Huhehaote Medicinal Company, (Huhehaote, China). The FCN herb pair (GuangZao and RouDouKou) is prepared at a ratio of 1:1. A TRIzol reagent Kit, SYBR® Premix Ex Taq™ II enzyme kit, and PrimeScript™RT Master Mix RT were purchased from Takara Bio, Inc. (Dalian, China), and a Total RNA Extraction Kit was purchased from Tiangen Biotech Co., Ltd. (Beijing, China).

The total RNA content was isolated from the testa with Trizol Reagent kit (TaKaRa, Inc., Dalian, China) following the manufacturer’s protocol. The purity and amount of the RNA from each sample was determined by Agilent 2100 and NanoDrop. The total RNA was treated with mRNA enrichment method using polyA tail connected magnetic beads with Oligo (dT). The DNA/RNA hybrid strand was selectively digested by RNaseH, and then the DNA probe was digested by DNaseI, and the desired RNA was obtained after purification. The mRNA was treated with fragmentation buffer to cleave into short fragments. Reverse transcription with random N6 primers was carried out, and then double-stranded DNA was synthesized. The double-stranded DNA was linearized and phosphorylate the 5′ end, and produce a sticky end with an “A” protruding from the 3′ end, and finally connected to a bubble-shaped linker with a protruding “T” at the 3′ end. The ligated product was then amplified by PCR using specific primers. The PCR products obtained from the previous step were thermally denatured into single-stranded DNA, and then a single-stranded circular DNA library was obtained by circularizing the single-stranded DNA with the help of a bridge primer. After that, sequencing was carried out using DNBSEQ platform.

Total RNA was extracted in accordance with the instructions of Trizol Reagent Kit (Takara, Shiga, Japan). The RNA concentration and purity were determined by ND-1000 nucleic acid protein analyzer and stored at −80 °C. PrimeScript RT Reagent Kit (Takara, Japan) and miRNA 1st Strand cDNA Synthesis Kit (by stem-loop) (Vazyme, Nanjing, China) were used to synthesize cDNA of mRNA and miRNA. qRT-PCR of mRNA and miRNA were performed using SYBR^®PrimeScriptTM RT-PCR Kit (Takara, Japan) and miRNA Universal SYBR qPCR Master Mix Kit (Vazyme, China). Then, 18S rRNA and U6 were used as reference genes. Primers used in present research were synthesized by Sangon Biotech (Shanghai) Co., Ltd., (Shanghai, China) and their sequences are shown in Tables S1 and S2. Each sample was repeated 3 times, and the quantitation data were calculated using the 2^−ΔΔCt.

The relative expression level of MDR1 was measured by quantitative real‐time PCR. The TRIzol Reagent Kit (Takara, Otsu, Japan) was applied to isolate total RNA, and the miRNA First Strand cDNA synthesis kit (Sangon Biotech, Shanghai, China) was applied to transcribe RNA into cDNA. Quantitative real‐time PCR was performed with SYBR® Prime Script™ RT‐PCR Kit (Invitrogen). The primer sequences were as follows: MDR1 forward: 5′‐CCCATCATTGCAATAGCAGG‐3′, reverse: 5′‐ TGTTCAAACTTCTGCTCCTGA‐3′; GAPDH forward: 5ʹ‐GTCTCCTCTGACTTCAACAGCG‐3ʹ, reverse: 5ʹ‐ACCACCCTGTTGCTGTAGCCAA‐3ʹ. The Mx3000P real‐time PCR system (Thermo Fisher) was used. The PCR conditions were described as follows: 95 °C for 15 min and then 40 cycles of 94 °C for 15 s, 60 °C for 1 min and 72 °C for 1 min. All procedures were conducted in triplicate. The 2^−ΔΔCt method was used to calculate the relative MDR1 expression.