Sybr green pcr mix

Manufactured by Thermo Fisher Scientific

Sourced in United States, Switzerland, Canada, China

SYBR Green PCR mix is a reagent designed for real-time quantitative PCR (qPCR) applications. It contains SYBR Green I dye, which binds to double-stranded DNA and emits fluorescent signal upon binding. The mix also includes all the necessary components for PCR amplification, such as DNA polymerase, dNTPs, and buffer.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

SYBR Green (3216 citations) SYBR Green mix (375 citations) SYBR Green Real-Time PCR Master Mixes (159 citations) SYBR Green PCR Master Mixes (8 citations) SYBR Green Real-Time PCR Master Mixes kit (7 citations) SYBR green RT-PCR master mixes (2 citations) SYBR Green One-Step RT-PCR Master Mixes (2 citations) Powerup™ SYBR Green PCR master mixes (2 citations)

217 protocols using sybr green pcr mix

Quantitative Expression Analysis of Target Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was extracted using a Simply P total RNA extraction kit (BioFlux, China) according to the protocols of the manufacturer. The cDNA was synthesized from 1 μg of total RNA by reverse transcription using a PrimeScript II first-strand cDNA synthesis kit (TaKaRa, Japan) following the manufacturer’s instructions, and was subjected to qPCR performed in triplicate using SYBR green PCR mix (Life Technologies, USA) on a LightCycler 480 II system (Roche, Switzerland). The cellular glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression was quantified as the internal control. The 2^-ΔΔCT method was used to calculate the relative expression of target genes compared to GAPDH. The primers used for qPCR are listed in Table 1.

Yin L., Liu X., Hu D., Luo Y., Zhang G, & Liu P. (2022). Swine Enteric Coronaviruses (PEDV, TGEV, and PDCoV) Induce Divergent Interferon-Stimulated Gene Responses and Antigen Presentation in Porcine Intestinal Enteroids. Frontiers in Immunology, 12, 826882.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was extracted using the Simply P Total RNA Extraction Kit (BioFlux, China) according to the manufacturer's instructions. Total RNA (1 μg) was reverse-transcribed to cDNA using the PrimeScript™ II First-Strand cDNA Synthesis Kit (Takara, China). The synthesized cDNA was subjected to qPCR performed in triplicate using a LightCycler^® 480 II real-time PCR instrument (Roche, Switzerland) and SYBR Green PCR mix (Life Technologies, USA) according to the manufacturer's instructions. All the data were acquired and analyzed using LightCycler^® 480 II software 1.5 based on the cycle threshold (^ΔΔCT) method (25 (link)). GAPDH served as the internal control. The amplification efficiency of qPCR primers ranged from 85.83 to 106.38%. The primers used in this assay were designed using Primer Premier 5 software and are listed in Table 1.

Li L., Xue M., Fu F., Yin L., Feng L, & Liu P. (2019). IFN-Lambda 3 Mediates Antiviral Protection Against Porcine Epidemic Diarrhea Virus by Inducing a Distinct Antiviral Transcript Profile in Porcine Intestinal Epithelia. Frontiers in Immunology, 10, 2394.

+ Open protocol

+ Expand

Prostate Cancer Gene Expression Analysis by qRT-PCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIZOL and used to generate cDNA for gene expression experiments [52 (link)]. Expression of target gene mRNA transcripts was determined by Realtime PCR with gene-specific primers and SYBR-green PCR mix (Life Technologies). The primer sequences were: forward 5′-AGCCCACGCTCAGTGTCTAT-3′ and reverse 5′-GGGCACTAGGATCATCTGTCA-3′ for RON; forward: 5′-AAGCTGACTTCTTCTGGAGCCTGT-3 and reverse 5′-TCTCCTTGGCAGAAACTCTGCTGT-3 for c-FLIP′; forward: 5′-GGCACCCAGCACAATGAAGATCAA-3′ and reverse: 5′-AGAAGCATTTGCGGTGGACGATG-3′ for β-actin; forward: 5′-ACACTGCCAACTGGCTGGAGATTA-3′; reverse: 5′ TGATTAGGGCTGTGTACGTGCTGT-3 for E-cadherin′; forward: 5′-TAACCCAAGGAGCAGGTAATCGCA-3 and reverse: 5′-GTTTCTTGCAGTTTGGGCACTCGT-3′ for ZEB-2; forward 5′-GATTGAGCATGGCTCTCTATTC-3 and reverse 5′ GGTGAGATGTTCCAGGTTTAAG-3 for FKBP1; forward 5′-CATGTGATGTCTGGTCTGAAT-3 and reverse 5′-GACACAGCTCAACAAAGAAAC-3 for PMEPA1. The relative expression changes of individual genes were determined using comparative c_t method. Data is expressed as gene expression changes relative to β-actin control. Changes in expression of RON and c-FLIP were analyzed using Origene PCA II cDNA array HPRT 302 and 303 (for RON and c-FLIP expression respectively) containing different Gleason grade human prostate tumors.

Batth I., Yun H., Hussain S., Meng P., Osumulski P., Huang T.H., Bedolla R., Profit A., Reddick R, & Kumar A. (2016). Crosstalk between RON and androgen receptor signaling in the development of castration resistant prostate cancer. Oncotarget, 7(12), 14048-14063.

+ Open protocol

+ Expand

Polysomal RNA-seq and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

All experiments were performed twice (biological replicates). Extracted RNA samples were divided. One half was pooled into three categories according to the ribosomal association: free ribonucleoprotein complex, light polysome and heavy polysome. RNA-seq template was generated from each of these categories using the TruSeq RNA sample preparation kit v2 (Illumina) and was sequenced on an Illumina HiSeq. From the remaining half, we prepared cDNA with the Superscript III reverse transcriptase (Life Technologies) and oligo(dT) primers, according to the manufacturer’s instructions. Quantitative PCR was performed to determine the abundance of transcripts using SYBR Green PCR mix (Life Technologies) and respective primers. Measurements were then normalized to luciferase abundance.
Oligonucleotides used for quantitative PCR of mouse mRNAs are as follows: Ophn1: forward 5′-CAAACCCCTGGAAACTTTTCG-3′, reverse 5′-ATGACAGATGTAAGTGGCGG-3′; Actb: forward 5′-TTCTTTGCA GCTCCTTCGTTGC-3′, reverse 5′-TGGATGGCTACGTACATGGCTG-3′; luciferase: forward 5′-ATCCGGAAGCGACCAACG-3′, reverse 5′- GTCGGGAAGACCTGCCAC-3′.

Viana Di Prisco G., Huang W., Buffington S.A., Hsu C.C., Bonnen P.E., Placzek A.N., Sidrauski C., Krnjević K., Kaufman R.J., Walter P, & Costa-Mattioli M. (2014). Translational control of mGluR-dependent long-term depression and object-place learning by eIF2α. Nature neuroscience, 17(8), 1073-1082.

+ Open protocol

+ Expand

Etv1 Binding and Repression in Rat Promoters

Check if the same lab product or an alternative is used in the 5 most similar protocols

The database of eukaryotic promoter (http://epd.vitalit.ch/) was used to choose the promoter regions of Etv1 binding and repression. The gene promoter region in this study was use the rat genome version rn6 as follows: MAG [positions 89,360,666-89,363,285 on chromosome (Chr) 1], P0 (positions 89,521,180-89,524,289 on Chr 13), Pmp22 (positions 49,535,934-49,538,691 on Chr 10), Zeb2 (positions 29,984,109 and 29,987,005 on Chr 3), and Runx2 (positions 18,562,029-18,564,997 on Chr 9), was divided into 2–3 parts for the design of primers, and each part was designed with a pair of primers. Primer sequences are provided in Table S5.
After fixation with 1% formaldehyde (Life Science, Louis, MO, USA) for 20 minutes, the pooled differentiating SCs were lysed and sonicated using a cell crusher (Scientz, Shanghai, China) at 29% power with 1 second interval on and off for 9 minutes until the DNA was fragmented to between 200 and 1,000 bp in lengths. The sheared chromatin was incubated with 5 µg of Etv1 antibody (Invitrogen, PA5-77975) at 4 °C, and the Magna ChIP G Kit (Millipore) was used to perform the ChIP assay in accordance with the manufacturer’s guidelines. Using SYBR green PCR mix (Life Technologies), RT-qPCR and the 2^−∆CT method were used to determine the relative fold enrichments of normalized samples to input chromatin.

Askar P., Xu J., Hu J., Shangguan J., Sun H., Zhou S., Yang X., Chen G., Su W, & Gu Y. (2022). The Etv1/Er81 transcription factor coordinates myelination-related genes to regulate Schwann cell differentiation and myelination. Annals of Translational Medicine, 10(16), 875.

+ Open protocol

+ Expand

Quantitative RT-qPCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular mRNA was extracted using the Simply P total RNA extraction kit (BioFlux, China) according to the manufacturer’s instructions. Total mRNA (1 μg) was reverse transcribed to cDNA using the PrimeScript II first-strand cDNA synthesis kit (TaKaRa, China), and relative gene expression levels were quantified by qPCR using SYBR green PCR mix (Life Technologies, USA) based on the cycle threshold (ΔΔC_T) method (42 (link)). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as the internal control. The primers were designed using Primer Premier 5 software and are listed in Table 1.

Li L., Fu F., Guo S., Wang H., He X., Xue M., Yin L., Feng L, & Liu P. (2019). Porcine Intestinal Enteroids: a New Model for Studying Enteric Coronavirus Porcine Epidemic Diarrhea Virus Infection and the Host Innate Response. Journal of Virology, 93(5), e01682-18.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Lung Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

1 μg total RNA from adult, P15, and new born lungs was reverse transcribed to cDNA using 1 μl of (dT) 12–18 primer (Invitrogen, Germany) and 1 μl of SuperScript™ II Reverse Transcriptase (RT) Kit (Invitrogen, Germany) according to the manufacturer's protocol. The reaction was incubated in a Biometra Trio Thermocycler (The Netherlands). The qRT-PCR of target genes, described in Table 2, was performed in the iCycler iQ5™ Real-Time PCR Detection System (Bio-Rad, USA). The reactions were set up with the SYBR™ Green PCR mix (Life Technologies) according to the manufacturer's protocol. The PCR cycle consisted of an initial cycle of 95°C for 3 min followed by 42 repeated cycles of 95°C for 15 s, 60°C annealing temperature for 30 s, and the primer extension at 72°C for 1 min. The real-time PCR primer pairs used in this study are listed in Table 2. All reactions were run in triplicates. Calculation of the relative gene expression was done by the 2^−ddC_T method, where dC_T = (C_Ttarget gene − C_Tinternal control gene) using GAPDH as an endogenous control.

El-Merhie N., Baumgart-Vogt E., Pilatz A., Pfreimer S., Pfeiffer B., Pak O., Kosanovic D., Seimetz M., Schermuly R.T., Weissmann N, & Karnati S. (2017). Differential Alterations of the Mitochondrial Morphology and Respiratory Chain Complexes during Postnatal Development of the Mouse Lung. Oxidative Medicine and Cellular Longevity, 2017, 9169146.

+ Open protocol

+ Expand

Quantifying miRNA and mRNA Levels by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted by TRIZOL method (Invitrogen, NY) and converted to cDNA using the TaqMan Reverse Transcription kit (Applied Biosystems, CA) in a thermal cycler at 16°C for 25~30 minutes, 41°C for 25~30 minutes, and 85°C for 10 minutes. qRT-PCR was using the SYBR Green PCR Mix (Life Technologies, CA) at 95°C for 13 minutes, 40 cycles at 95°C for 17 seconds, and 60°C for 2 minutes. These reference genes (GAPDH) were used as control expression. The experimental data were calculated using 2^−ΔΔCt method. Sequence of primers: miR-33a-5p Forward: 5′-GATCCTCAGTGCATTGTAGTTGC-3′, Reverse: 5′-CTCTGTCTCTCGTCTTGTTGGTAT-3′. U6 Forward: 5′-CTCGCTTCGGCAGCACA-3′, Reverse: 5′-AACGCTTCACGAATTTGCGT-3′. RAP2A Forward: 5′-ACAATGGTGGACGAACTCTTT-3′, Reverse: 5′-CAGAACAGCATGGGTCATCTT-3′. GAPDH Forward: 5′-GGCTGTTGTCATACTTCTCATGG-3′; Reverse: 5′-AGGAAAAGCATCACCCGGAG-3′.

Ti G., Guo Z., Li L., Lv Y., Yang B., Wang J., Guo R., Chen Y., Meng D, & Li F. (2022). miR-33a-5p Targets RAP2A to Mediate the Sensitivity of Gastric Cancer Cells to 5-FU. Disease Markers, 2022, 9701047.

+ Open protocol

+ Expand

RT-qPCR: Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time quantity polymerase chain reaction (RT-qPCR) amplification and detection were performed using the SYBR Green PCR Mix (Life Technologies) in a StepOne real-time PCR system (Life Technologies) according to the manufacturer’s protocol. Gene expression was normalized using β-actin as a reference gene. The primers were listed in Table 1.Table 1

The primers sequence involved in the paper

gene	forward	reverse
PPP1R3C	5’-ATTTGCTTGGCACATTCACC-3’	5′- GTGGGCTCTTCCATTCCTTC-3’
SLC38A2	5’-CAGTTGGGACATAAGGCATACG-3’	5’-ATAGTCGCCGTTCAGATACCAC-3’
OSGIN1	5′- GCAGCAGATGATGCGTGAC -3’	5′- GGAGCCGATGAGGACGAG − 3’
ZFP189	5′- GAAAGACATCGAACCACAGGG − 3’	5’-TGTTCCTCAGTCAAAGAATCACG-3’
β-actin	5’-CCCATCTATGAGGGTTACGC-3’	5’-TTTAATGTCACGCACGATTTC-3’

Dang Y., Hao S., Zhou W., Zhang L, & Ji G. (2019). The traditional Chinese formulae Ling-gui-zhu-gan decoction alleviated non-alcoholic fatty liver disease via inhibiting PPP1R3C mediated molecules. BMC Complementary and Alternative Medicine, 19, 8.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells or sciatic nerves using the RNeasy Plus Mini Kit (74136, Qiagen, CA, USA), complementary DNA was obtained by reverse transcription using the Superscript Kit (11904018, Invitrogen CA, USA), and then SYBR green PCR mix (A46012, Life Technologies, Gaithersburg, MD, USA) was used to perform quantitative real-time PCR (qRT-PCR). Data analysis was performed using the ^ΔΔCT method. Primer sequences can be found in Additional file 5: Table S4.2.

Xu J., Zhang B., Cai J., Peng Q., Hu J., Askar P., Shangguan J., Su W., Zhu C., Sun H., Zhou S., Chen G., Yang X, & Gu Y. (2023). The transcription factor Stat-1 is essential for Schwann cell differentiation, myelination and myelin sheath regeneration. Molecular Medicine, 29, 79.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!