Maxima first strand cdna synthesis kit

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany, France, Lithuania, Italy, United Kingdom, Denmark, Canada, Spain, Japan, China, Poland

The Maxima First Strand cDNA Synthesis Kit is a reagent system used for the reverse transcription of RNA to complementary DNA (cDNA). It includes a thermostable reverse transcriptase enzyme, optimized reaction buffer, and other necessary components for the cDNA synthesis process.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Maxima First Strand cDNA Synthesis Kits for RT-qPCR Maxima First Strand cDNA Synthesis CDNA synthesis kit CDNA kits

1 018 protocols using maxima first strand cdna synthesis kit

mRNA Expression Analysis of GluN and GluA Receptors

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For mRNA expression analysis on MBMECs, total RNA was extracted using a Quick RNA Micro Prep Kit (Zymo Research). cDNA was synthesized from 300 ng of total RNA using a Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific). All experiments were performed according to the manufacturers’ instructions and as described before [16 (link)]. For quantitative real-time PCR (qPCR) 4 µl cDNA were used together with Maxima Probe Rox qPCR mix supplemented with mouse GluN1 (Mm00433790_m1), mouse GluN2A (Mm00433802_m1), mouse GluN2B (Mm00433820_m1), mouse GluA1 (Mm00433753_m1), mouse GluA2 (Mm00433753_m1), mouse GluA3 (Mm00497506_m1), mouse GluA4 (Mm00444755_m1) and 18S rRNA (Hs99999901_s1) as endogenous control for TaqMan gene expression assays. For qPCR with QuantiTect Primers 4 µl of cDNA were used together with a SYBR green master mix for GluN2C (QT00127015), GluN2D (QT00154378), GluN3A (QT00290843) and GluN3B (QT00173684) expression assays. 18S rRNA was used as endogenous control. All qPCRs were performed using the StepOnePlus System for 40 cycles (Applied Biosystems). Data were calculated using the change in cycle threshold (ΔCT) compared to the 18sRNA [17 (link)].

Epping L., Schroeter C.B., Nelke C., Bock S., Gola L., Ritter N., Herrmann A.M., Räuber S., Henes A., Wasser B., Fernandez-Orth J., Neuhaus W., Bittner S., Budde T., Platten M., Kovac S., Seebohm G., Ruck T., Cerina M, & Meuth S.G. (2022). Activation of non-classical NMDA receptors by glycine impairs barrier function of brain endothelial cells. Cellular and Molecular Life Sciences, 79(9), 479.

+ Open protocol

+ Expand

Quantitative Analysis of Mesenchymal Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time PCR analyses were carried out to evaluate the mRNA levels of ACTA2, FN1, COL1A1, HDAC4, TNC, SPARC, BMP2, BMP4, and BMP6. hDFs and hDPSCs were homogenized, and total RNA was extracted and purified using the PureLink RNA columns (Thermo Fisher Scientific). cDNA synthesis was performed using Maxima First Strand cDNA Synthesis Kit with DNase I treatment (Thermo Fisher Scientific). Quantitative real-time PCRs were performed using SYBR Green Master Mix (Bio-Rad) on the CFX Connect Real-time PCR instrument (Bio-Rad, Hercules, CA, United States) with the oligonucleotides. The oligonucleotides used in this study are listed in Table 1 (all obtained from Sigma-Aldrich).
Relative quantification was calculated from the ratio of the cycle number (Ct) at which the signal crossed a threshold set within the logarithmic phase of the given gene to that of the reference hRPLP0. Mean values of the duplicate results of three independent experiments for each sample were used as individual data for 2^−ΔΔCt statistical analysis.

Pisciotta A., Di Tinco R., Bertani G., Orlandi G., Bertoni L., Pignatti E., Orciani M., Sena P., Bertacchini J., Salvarani C, & Carnevale G. (2023). Human dental pulp stem cells (hDPSCs) promote the lipofibroblast transition in the early stage of a fibro-inflammatory process. Frontiers in Cell and Developmental Biology, 11, 1196023.

+ Open protocol

+ Expand

RNA Extraction and RT-PCR Procedure

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extraction was performed using RNeasy Mini Kit (QIAGEN, Hilden, Germany), and 1 μg each of the resultant total RNAs were subjected to Reverse Transcription (RT) using the Maxima First-Strand cDNA Synthesis Kit (Thermo Fischer Scientific, Waltham, MA) by following the manufacturer’s protocol. Overall, 1 μl each of the cDNAs was then used either for conventional PCR reactions or qPCR reactions. Conventional PCR reactions were performed with 35 cycles using HIFI PCR premix (Clonetech, USA). qPCR was performed using 1 μL of cDNA with Luna Universal qPCR Master Mix (# M3003S, New England Biolabs, USA) following the manufacturer’s protocol. The primers are summarized in the resource table.

Noyes C., Kitajima S., Li F., Suita Y., Miriyala S., Isaac S., Ahsan N., Knelson E., Vajdi A., Tani T., Thai T.C., Xu D., Murai J., Tapinos N., Takahashi C., Barbie D.A, & Yajima M. (2023). The germline factor DDX4 contributes to the chemoresistance of small cell lung cancer cells. Communications Biology, 6, 65.

+ Open protocol

+ Expand

Quantitative Analysis of Airway Mast Cell Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from BALF cell pellets using RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) per manufacturer instructions. Quantification and purity of RNA extracted was assessed via NanoDrop 2000c Spectrophotometer (Thermo Fisher Scientific, Waltham, MA). RNA integrity was analyzed on a subset of samples using 2100 Bioanalyzer and the RNA 6000 Nano kit (Agilent, Santa Clara, CA). Reverse transcription and cDNA synthesis was performed on 200 ng of RNA using Maxima First Strand cDNA synthesis kit (Thermo Fisher Scientific) and stored at −80°C. Taqman Gene Expression Assays were used for all target genes; β-actin (actb), CD117 (ckit), tryptase (tpsb2), chymase (cma1), and carboxypeptidase A3 (cpa3) (Applied Biosystems, Foster City, CA) (Supplementary Table 2 for primer information). Real time PCR was performed on 10 ng cDNA, with Taqman Fast Advanced Master Mix (Applied Biosystems). QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems) was used for thermal cycling at recommended settings. Results were normalized to β-actin and relative quantification was performed using 2^−ΔΔCt method (33 (link), 34 (link)). Plate results were used when β-actin standard deviations were ≤ 0.7. Average standard deviation of all plates run was 0.55.

Woodrow J.S., Hines M., Sommardahl C., Flatland B., Lo Y., Wang Z., Sheats M.K, & Lennon E.M. (2023). Initial investigation of molecular phenotypes of airway mast cells and cytokine profiles in equine asthma. Frontiers in Veterinary Science, 9, 997139.

+ Open protocol

+ Expand

Quantifying Differential Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Five differentially expressed genes were chosen for validation of RNA-Seq results: KIAA1210, MAP3 K15, MAGEA10, FATE1 and PRND. The same RNA samples used for RNA-Seq were used here for gene expression validation using quantitative real-time PCR (qRT-PCR). Total RNA was quantified through spectrometry using Nanodrop 2000c (Thermo Fisher Scientific) and 1000 ng of total RNA were treated with 1 U of DNase I (Thermo Scientific) in a 10 μL reaction containing 1 μL + DNase-RNase-Free water at 37 °C for 10 min. The cDNA was prepared using the Maxima First Strand cDNA Synthesis kit (Thermo Fisher, Waltham, MA). Reactions were run using StepOnePlus system (Applied Biosystems, Foster City, CA). Gene GAPDH was chosen as internal control because of its stable expression across all RNA-Seq samples. The association between normalized gene expression values (ΔCt) and maternal diets was tested using a likelihood ratio test [40 (link)]. The relative gene expression values were calculated using the 2^-ΔΔCt method [41 (link)].

Louvandini H., Corrêa P.S., Amorín R., Liu L., Ieda E.H., Jimenez C.R., Tsai S.M., McManus C.M, & Peñagaricano F. (2020). Gestational and lactational exposure to gossypol alters the testis transcriptome. BMC Genomics, 21, 59.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The ARPE-19 and TOV112D cell lines were subjected to the MB-50, METABLOC, and carboplatin-50 treatments for 24 h, and then the total RNA was extracted using RNA extraction kits (Qiagen, Cat. 74004, Toronto, ON, Canada). The total RNA underwent a DNase treatment and was then reverse-transcribed using the Maxima First Strand cDNA synthesis kit, which included ds DNase (ThermoFisher Scientific, Cat. K1641). We assessed the gene expression through assays crafted via the Universal Probe Library (Roche, Cat. UPL1THRU10, Laval, QC, Canada). A standard curve was established for every qPCR assay to confirm that its efficiency ranged from 90% to 110%. The QuantStudio qPCR device (ThermoFisher Scientific) was employed to measure the amplification rate. To determine the relative expression (RQ = 2^−ΔΔCT), we utilized the Expression Suite software v1.2 (ThermoFisher Scientific, Burlington, Canada), taking both GAPDH and B2M as internal controls.

da Veiga Moreira J., Nleme N., Schwartz L., Leclerc-Desaulniers K., Carmona E., Mes-Masson A.M, & Jolicoeur M. (2024). Methylene Blue Metabolic Therapy Restrains In Vivo Ovarian Tumor Growth. Cancers, 16(2), 355.

+ Open protocol

+ Expand

RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from cells was isolated using PureLink RNA Mini Kit (Ambion, 1283-018A) according to the manufacturer’s instructions. RNA was retrotranscribed into cDNA using Maxima First Strand cDNA Synthesis Kit (Thermo Scientific, K1642) and subjected to quantitative real-time PCR (qRT-PCR) on an ABI PRISM 7500 machine. qPCRs (20 μl) contained 10 μl of SYBR Green PCR supermix (2×), 4 μl of a forward and reverse primer mix (final concentration, 200 nM), and 6 μl of cDNA (20 ng). Primers sequences are listed in table S4.

Mzoughi S., Di Tullio F., Low D.H., Motofeanu C.M., Ong S.L., Wollmann H., Wun C.M., Kruszka P., Muenke M., Hildebrandt F., Dunn N.R., Messerschmidt D.M, & Guccione E. (2020). PRDM15 loss of function links NOTCH and WNT/PCP signaling to patterning defects in holoprosencephaly. Science Advances, 6(2), eaax9852.

+ Open protocol

+ Expand

Quantitative PCR gene expression analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For PCR validation, RNA was transcribed to cDNA (Maxima First Strand cDNA Synthesis Kit, Thermo Fisher Scientific) and subjected to quantitative PCR with TaqMan Universal Master Mix (Thermo Fisher Scientific) and ABI Prism 7500 sequence detection system (Applied Biosystems, Foster City, CA, USA) using the following TaqMan Gene Expression assays (Thermo Fisher Scientific); Mm00432403_m1 (Cd36), Mm03047343_m1 (Cd68), Mm00617672_m1 (Cidec), Mm00444699_m1 (Cxcl14), Mm00725580_s1 (Cyp2c29), Mm00472168_m1 (Cyp2c55), Mm00731567_m1 (Cyp3a11), Mm01607174_mH (Cyp3a59), Mm00487306_m1 (Cyp46a1), Mm00492632_m1 (Igfbp2), Mm00434228_m1 (IL1b), Mm00440181_m1 (Lepr), Mm00503358_m1 (Mogat1), Mm01184322_m1 (Pparg), Mm04208126_mH (Saa2), Mm00446229_m1 (Slc2a2), Mm00443260_g1 (Tnfa). QuantiTect Primer Assays (Qiagen) were used to measure Pparg variants 1 and 2 (QT00100296 and QT02266166, respectively). Primers and probe for the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase Gapdh) were GCATGGCCTTCCGTGTTC (forward, 300 nM), GATGTCATCATACTTGGCAGGTTT (reverse, 300 nM) and TCGTGGATCTGACGTGCCGCC (probe, 150 nM) (Metabion GmbH, Planegg, Germany). Results were calculated using the delta-delta CT method, and all mRNA levels were normalized against GAPDH.

Ryyti R., Pemmari A., Peltola R., Hämäläinen M, & Moilanen E. (2021). Effects of Lingonberry (Vaccinium vitis-idaea L.) Supplementation on Hepatic Gene Expression in High-Fat Diet Fed Mice. Nutrients, 13(11), 3693.

+ Open protocol

+ Expand

Oocyte Total RNA Extraction and qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from oocytes was isolated with the Arcturus PicoPure RNA Isolation Kit from Applied Biosystems following the manufacturer’s instructions. Reverse transcription reactions were done with twenty eight nanograms of RNA using the Maxima First Strand cDNA Synthesis Kit for RT-qPCR with dsDNase (Thermo Fisher Scientific). cDNA was quantified by qPCR with the Applied Biosystems 7500 FAST Real-Time PCR System using Power SYBR green PCR Master Mix from Thermo Fisher Scientific. The sequences of the primers used are the following: Chek1-For: 5’- AAGCCACGAGAATGTAGTGAAA-3’, Chek1-Rev: 5’- AGCATCTTGTTCAGGCATCC-3’, Actb-For: 5’-CCAACCGTGAAAAGATGACC-3’, Actb-Rev: 5’-ACCAGAGGCATACAGGGACA-3’. Values were normalized to the expression of Actb housekeeping gene.

Ruth K.S., Day F.R., Hussain J., Martínez-Marchal A., Aiken C.E., Azad A., Thompson D.J., Knoblochova L., Abe H., Tarry-Adkins J.L., Gonzalez J.M., Fontanillas P., Claringbould A., Bakker O.B., Sulem P., Walters R.G., Terao C., Turon S., Horikoshi M., Lin K., Onland-Moret N.C., Sankar A., Hertz E.P., Timshel P.N., Shukla V., Borup R., Olsen K.W., Aguilera P., Ferrer-Roda M., Huang Y., Stankovic S., Timmers P.R., Ahearn T.U., Alizadeh B.Z., Naderi E., Andrulis I.L., Arnold A.M., Aronson K.J., Augustinsson A., Bandinelli S., Barbieri C.M., Beaumont R.N., Becher H., Beckmann M.W., Benonisdottir S., Bergmann S., Bochud M., Boerwinkle E., Bojesen S.E., Bolla M.K., Boomsma D.I., Bowker N., Brody J.A., Broer L., Buring J.E., Campbell A., Campbell H., Castelao J.E., Catamo E., Chanock S.J., Chenevix-Trench G., Ciullo M., Corre T., Couch F.J., Cox A., Crisponi L., Cross S.S., Cucca F., Czene K., Smith G.D., de Geus E.J., de Mutsert R., de Vivo I., Demerath E.W., Dennis J., Dunning A.M., Dwek M., Eriksson M., Esko T., Fasching P.A., Faul J.D., Ferrucci L., Franceschini N., Frayling T.M., Gago-Dominguez M., Mezzavilla M., García-Closas M., Gieger C., Giles G.G., Grallert H., Gudbjartsson D.F., Gudnason V., Guénel P., Haiman C.A., Håkansson N., Hall P., Hayward C., He C., He W., Heiss G., Høffding M.K., Hopper J.L., Hottenga J.J., Hu F., Hunter D., Ikram M.A., Jackson R.D., Joaquim M.D., John E.M., Joshi P.K., Karasik D., Kardia S.L., Kartsonaki C., Karlsson R., Kitahara C.M., Kolcic I., Kooperberg C., Kraft P., Kurian A.W., Kutalik Z., Bianca M.L., LaChance G., Langenberg C., Launer L.J., Laven J.S., Lawlor D.A., Marchand L.L., Li J., Lindblom A., Lindstrom S., Lindstrom T., Linet M., Liu Y., Liu S., Luan J., Mägi R., Magnusson P.K., Mangino M., Mannermaa A., Marco B., Marten J., Martin N.G., Mbarek H., McKnight B., Medland S.E., Meisinger C., Meitinger T., Menni C., Metspalu A., Milani L., Milne R.L., Montgomery G.W., Mook-Kanamori D.O., Mulas A., Mulligan A.M., Murray A., Nalls M.A., Newman A., Noordam R., Nutile T., Nyholt D.R., Olshan A.F., Olsson H., Painter J.N., Patel A.V., Pedersen N.L., Perjakova N., Peters A., Peters U., Pharoah P.D., Polasek O., Porcu E., Psaty B.M., Rahman I., Rennert G., Rennert H.S., Ridker P.M., Ring S.M., Robino A., Rose L.M., Rosendaal F.R., Rossouw J., Rudan I., Rueedi R., Ruggiero D., Sala C.F., Saloustros E., Sandler D.P., Sanna S., Sawyer E.J., Sarnowski C., Schlessinger D., Schmidt M.K., Schoemaker M.J., Schraut K.E., Scott C., Shekari S., Shrikhande A., Smith A.V., Smith B.H., Smith J.A., Sorice R., Southey M.C., Spector T.D., Spinelli J.J., Stampfer M., Stöckl D., van Meurs J.B., Strauch K., Styrkarsdottir U., Swerdlow A.J., Tanaka T., Teras L.R., Teumer A., Porsteinsdottir U., Timpson N.J., Toniolo D., Traglia M., Troester M.A., Truong T., Tyrrell J., Uitterlinden A.G., Ulivi S., Vachon C.M., Vitart V., Völker U., Vollenweider P., Völzke H., Wang Q., Wareham N.J., Weinberg C.R., Weir D.R., Wilcox A.N., van Dijk K.W., Willemsen G., Wilson J.F., Wolffenbuttel B.H., Wolk A., Wood A.R., Zhao W., Zygmunt M., Chen Z., Li L., Franke L., Burgess S., Deelen P., Pers T.H., Grøndahl M.L., Andersen C.Y., Pujol A., Lopez-Contreras A.J., Daniel J.A., Stefansson K., Chang-Claude J., van der Schouw Y.T., Lunetta K.L., Chasman D.I., Easton D.F., Visser J.A., Ozanne S.E., Namekawa S.H., Solc P., Murabito J.M., Ong K.K., Hoffmann E.R., Murray A., Roig I, & Perry J.R. (2021). Genetic insights into biological mechanisms governing human ovarian ageing. Nature, 596(7872), 393-397.

+ Open protocol

+ Expand

Reverse Transcription and qPCR Analysis

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Maxima First-Strand cDNA Synthesis Kit (Thermo Scientific) was used to reverse-transcribe the 10 μg of total RNAs. Real-time PCR (HOT FIREPol^® EvaGreen^® qPCR Mix Plus, Solis BioDyne, Estonia) was carried out on the Applied Biosystems^® StepOne™ Real-Time PCR Systems (Life Technologies, United States). For each gene of interest, we used HPLC-purified oligonucleotide primers from Sigma-Aldrich (refer to Supplementary Table 4).
The comparative threshold cycle (ΔΔCt) method was used for the relative quantification of gene transcription. The 16S rRNA gene was used to normalize the relative amount of target cDNA as an internal reference (Kwiatek et al., 2014 (link), 2015 (link)). Data represent averages obtained by measurement of three independent biological samples.

Adamczyk-Poplawska M., Bacal P., Mrozek A., Matczynska N., Piekarowicz A, & Kwiatek A. (2022). Phase-variable Type I methyltransferase M.NgoAV from Neisseria gonorrhoeae FA1090 regulates phasevarion expression and gonococcal phenotype. Frontiers in Microbiology, 13, 917639.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!