AAV-PHP.eB viruses were packaged in AAVpro 293T cells (Clontech, 632273). Cells were harvested by cell lifter (Biologix, 70-2180) at 72 h after cotransfection with PHP.eB (Addgene, 103005), pAdDeltaF6 (Addgene, 112867) and transfer plasmids using polyethylenimine MAX (Polysciences, 24 765). Cell pellets were suspended in 1× gradient buffer (10 mm Tris-HCl, pH 7.6, 150 mm NaCl, 10 mm MgCl2). Cells were lysed by five repeated cycles of freezing in liquid nitrogen for 7 min, thawing in 37°C water bath for 3 min, and vortexing for 2 min. Cell lysate was mixed with ≥50 U/ml of Benzonase nuclease (Millipore, E1014) and incubated at 37°C for 30 min. After centrifugation at 20,000 × g for 30 min at 4°C, the supernatant was transferred to a iodixanol (Optiprep, D1556) step gradient (15%, 25%, 40%, and 58%) for ultracentrifugation. After centrifugation at 40,000 rpm for 4 h at 4°C, virus particles were collected from the layer of 40% iodixanol gradient using a sterile syringe. Purified AAVs were concentrated using Amicon filters (EMD, UFC801096) and formulated in sterile PBS supplemented with 0.01% Pluronic F68 (Invitrogen, 24040032). Virus titers were determined by qPCR using a linearized AAV plasmid as a standard.
Paddeltaf6
Manufactured by Addgene
Sourced in United States
PAdDeltaF6 is a plasmid that contains the adenovirus type 5 (Ad5) genome with a deletion in the E1 and E3 regions, allowing for the insertion of foreign genes. This plasmid is commonly used for the production of recombinant adenovirus vectors.
Automatically generated - may contain errors
Lab products found in correlation
Paav2 9, by Addgene (4 mentions)
Paav2 1, by Addgene (4 mentions)
Paav2 9n, by Addgene (3 mentions)
Paav hsyn egfp, by Addgene (2 mentions)
Amicon ultra 15 centrifugal filter unit, by Merck Group (2 mentions)
Benzonase, by Merck Group (2 mentions)
Paav2 5, by Addgene (2 mentions)
Paav2 8, by Addgene (2 mentions)
Pucmini icap php eb, by Addgene (2 mentions)
Iq sybr green supermix kit, by Bio-Rad (2 mentions)
Pei max, by Polysciences (2 mentions)
Benzonase nuclease, by Merck Group (1 mentions)
Pluronic f 68, by Thermo Fisher Scientific (1 mentions)
Aavpro 293t cells, by Takara Bio (1 mentions)
Polyethylenimine max, by Polysciences (1 mentions)
Aavpro purification kit, by Takara Bio (1 mentions)
Aavpro 293t cell line, by Takara Bio (1 mentions)
Cfx96, by Bio-Rad (1 mentions)
Poloxamer 188, by Merck Group (1 mentions)
Himac cp80wx, by Hitachi (1 mentions)
22 protocols using paddeltaf6
1
Large-Scale Purification of AAV Vectors
2
Adeno-associated Virus Production and Delivery
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AAV2/9 were prepared as previously described using the iodixanol density gradient protocol [16 (link)]. The helper plasmids pAd-DeltaF6 (James M. Wilson, Addgene 112867) and p5E18V2/9 (a kind gift from J. Kleinschmidt) were used for the production. The viral suspension was concentrated to a final volume of 200 µl and the titre (number of viral genomes/ml) was confirmed by qPCR. The following constructs were expressed: an empty vector hSyn.NLS.myc (negative control), hSyn-PV.NLS.mCherry, (previously reported by [55 (link)]), hSyn-CaMBP4.flag.mCherry (described by [62 (link)]), hSyn-TNFRSF11b-P2A-mCherry (Vigene biosciences); pAAV(9)-pCAG-A7-floxed-PSAM(L141F, Y115F)-GlyR-GFP-WPRE (inhibitory PSAM(GLY)-GFP construct; Vector Biolabs). The full list of constructs can be found in Additional file 8 : Table S3.
3
Generation of AAV1/2-hSyn-GFP Particles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AAV1/2.hSyn-GFP particles were generated by co-transfection of HEK293T cells with AAV2/1 (Addgene 112862), AAV2/2 (Addgene 104963), adenovirus helper plasmid pAdDeltaF6 (Addgene 112867) and pAAV-hSyn-EGFP (Addgene 50465). Virus particles were purified by iodixanol gradient in at T70i ultracentrifuge rotor as previous [41 (link)]. Viral purity was confirmed by the presence of three bands following SDS-PAGE and staining with Coomassie InstantBlue and viral titre was determined by quantitative PCR.
4
Packaging and Purification of AAV Vectors
5
CRISPR-Cas9 Knockdown of Mouse Gpx4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A pair of guide RNAs targeting mouse Gpx4 locus were designed using CRISPick (Broad Institute Genetic Perturbation Platform): gdRNA#1:GTCGGCGGCGCCTTGGCTAC; gdRNA#2: GGTGACTACCTACGGTGAGT. Both gdRNAs were cloned into an AAV-U6gRNA1-U6gRNA2-TnT-Cre plasmid (Addgene#87682), and co-transfected with pAAV2/9n (Addgene#112865) and pAdDeltaF6 (Addgene#112867) into AAVpro 293T cell Line (Takara, Cat#632273) following protocol described previously.62 (link) AAV9 particles were harvested from the cell culture using AAVpro Purification Kit (Takara 6675) following manufacturer’s guidelines.
6
Preparation and Purification of AAV Vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AAVs were generated by co-transfection of pAAV vector containing either GFP or hACE2 gene, pAAV2/8 (#112864) or pAAV2/9 (#112865), and helper plasmid pAdDeltaF6 (#112867; Addgene) in a 1:1:1 molar ratio using polyetherimide. The cell culture media were changed 16 h later, and the cells were harvested at 72 h post-transfection. The harvested cells were lysed in AAV lysis buffer (150 mM NaCl, 20 mM Tris pH 8.0) through 3 cycles of freezing and thawing, followed by incubation with Benzonase (E8263, Sigma-Aldrich) for the removal of nucleic acid, and centrifugation. For purification, the supernatant containing viruses was transferred to the top of the iodixanol gradient (15%, 25%, 40%, and 60%) in a QuickSeal tube and centrifuged at 280,000 × g for 3 h at 14°C (Himac CP80WX, P90AT rotor, Hitachi). The viral fraction was collected by puncturing the QuickSeal tube at the interface of the 60% and 40% gradients with an 18G needle. The collected viruses were concentrated using Amicon Ultra-15 Centrifugal Filter Unit (UFC910096, Sigma-Aldrich) and washed 2 times with PBS containing 0.1% Poloxamer 188 (P5556, Sigma-Aldrich) and 3 times with PBS. For AAV titration, 5 μL of the virus were incubated with DNase and proteinase K sequentially to eliminate any plasmid DNA carried over. Then, the number of genome-containing particles of an AAV was determined by quantitative PCR (CFX96, Bio-Rad).
7
Generating AAVs for BMP2 Overexpression
8
Lentiviral and AAV-mediated H3.3 expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral constructs were generated as previously described (18 (link)). Briefly, lenti-H3.3 constructs [wildtype (WT) vs. (Q5A)-Flag-HA] were cloned into a pCDH-RFP vector via PCR and enzyme restriction digestion. Plasmids were purified and sent to GENEWIZ for sequence validation. pCDH-GFP-H3.3 plasmids were then sent to Cyagen Biosciences for lentiviral packaging. For cultured cerebellar granule neuron experiments, pAAV-CMV-H3.3-IRES-GFP constructs [wildtype (WT) vs. (Q5A)-Flag-HA vs. empty] were packaged as follows: 70%−80% confluent HEK293T cells were transfected pAAV2/1 (Addgene 112862), pAdDeltaF6 (Addgene 112867), and pAAV-CMV-IRES-GFP or pAAV-CMV-H3.3-WT-IRES-GFP or pAAV-CMV-H3.3-Q5A-IRES-GFP with PEI reagent (Polysciences, #26008-5). 48–72 hours after transfection, the media with AAVs were collected by centrifuge. AAV particles were precipitated by adding 10% volume of PEG 8000-NaCl solution (40% PEG 8000, 2.5 M NaCl, pH 7.4). Next, the AAV particles were resuspended in granule neurons culture medium.
9
Generating Recombinant AAV Vectors for FMRP Isoforms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We replaced tdTomato in the pAAV-CAG-tdTomato plasmid (Addgene, no. 59462) with two different human FMR1 transcripts that encode FMRP isoform 1 and FMRP isoform 15, respectively (isoform nomenclature follows that in Pretto et al.9 (link)). The CAG promoter in pAAV-CAG-tdTomato, pAAV-CAG-FMRP isoform 1, and pAAV-CAG-FMRP isoform 15 plasmids were then replaced with two different FMR1 endogenous promoter subdomains (P1 and P2) that were synthesized by YouBio (Changsha, Hunan, China) (Figure 1 C).
Virus packaging was carried out following a protocol described previously.31 (link) In brief, pAAV-FMR1-P2-tdTomato, pAAV-FMR1-P2-FMRP isoform 1, and pAAV-FMR1-P2-FMRP isoform 15 plasmids were individually co-transfected with pAAV2/9 (Addgene, no. 112865) and pAd-deltaF6 (Addgene, no. 112867) plasmids into HEK293T cells using PEI. Generated viruses were purified by density gradient centrifugation with iodixanol. Viral titrations were determined using qRT-PCR. Standard curves were generated using plasmids with known copy numbers, and vector genome copies were calculated based on standard curves.
Virus packaging was carried out following a protocol described previously.31 (link) In brief, pAAV-FMR1-P2-tdTomato, pAAV-FMR1-P2-FMRP isoform 1, and pAAV-FMR1-P2-FMRP isoform 15 plasmids were individually co-transfected with pAAV2/9 (Addgene, no. 112865) and pAd-deltaF6 (Addgene, no. 112867) plasmids into HEK293T cells using PEI. Generated viruses were purified by density gradient centrifugation with iodixanol. Viral titrations were determined using qRT-PCR. Standard curves were generated using plasmids with known copy numbers, and vector genome copies were calculated based on standard curves.
10
Generation of Combined AAV1/2-mCherry Virus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An AAV expressing mCherry under the control of the CAGs promoter was generated in a combined 1 and 2 serotype using the triple transfection helper-free method. In brief, HEK293T cells in culture were transfected with 3 plasmids in a 1:(0.5:0.5):1 ratio; the first containing essential viral genes such as E2 and E4 (pAdDeltaF6; Addgene plasmid # 112867), the second which determines the AAV serotype was in this case equimolar amounts of both serotype 1 (AAV2/1; Addgene plasmid # 112862) and serotype 2 (AAV2/2; Addgene plasmid # 104963) plasmids to generate AAV particles of a mixed 1 and 2 serotype and the third which dictates the packaged contents of the virus particles and contained mCherry under control of the CAGs promoter both flanked by two ITR sites (Addgene plasmid # 91947). Transfection was undertaken when the cells reached 60-70% confluence using a 4:1 (v:w) ratio of Polyethylenimine (PEI) to plasmid DNA. 60 – 72 hours after transfection, both supernatant and cells were processed to recover the virus. Viral titer was measured by qPCR analysis with primers specific to the ITR region of the packaging plasmid (fwd ITR primer: 5’-GGAACCCCTAGTGATGGAGTT, rev ITR primer: 5’-CGGCCTCAGTGAGCGA). We named this mixed serotype virus AAV2/1 + 2-CAGS-mCherry.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!