The largest database of trusted experimental protocols

27 protocols using ivacaftor

1

Preparation and Administration of Ivacaftor

Check if the same lab product or an alternative is used in the 5 most similar protocols
Reagents were freshly constituted for experiments. Forskolin (20 μM) and amiloride (10 μM) were purchased from Selleckchem and CFTRinh-172 (20 μM) from MilliporeSigma. Ivacaftor was purchased from Selleckchem and reconstituted on delivery with DMSO (Thermo Fisher Scientific) before aliquoting and storage at –80°C. We prepared single doses of Ivacaftor or vehicle within 1 hour of intraperitoneal (i.p.) administration. Doses were 40 mg/kg Ivacaftor in 5% DMSO, 5% Tween-80, 40% PEG300 (all from Selleckchem), and 50% of 0.9% saline (Grifols) solution. Vehicle was the identical weight-based solution volume without Ivacaftor.
+ Open protocol
+ Expand
2

Exploring WNK463 and Ivacaftor Effects

Check if the same lab product or an alternative is used in the 5 most similar protocols
WNK463 and ivacaftor were purchased from Selleckchem. Other reagents were purchased from MilliporeSigma.
+ Open protocol
+ Expand
3

Cystic Fibrosis Therapeutic Compound Evaluation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lumacaftor (VX-809) and Ivacaftor (VX-770) were purchased from Selleckchem via ThermoFisher (Pittsburgh, PA); collagen and bovine serum type1 were obtained from Corning (Bedford, MA), Fibronectin and MQAE dye were purchased from Life Technology (Eugene, OR); SYBR® green PCR master mix was obtained from Applied Biosystems (Warrington, UK); PCR custom primers hQCF3 GACAGTTGTTGGCGG TTGCT (sense) and hQCF4 ACCCTCTGAAGGCTCCAGTTC (Antisense) were synthesized by Invitrogen (Carlsbad, CA); procirol AT05 (glycerol distearate) GATTEFOSSE, sequalene, and span 85 were purchased from Sigma (Sant-Louis, MO); tween 80 and polyethylene glycol (PEG 2000) were purchased from Avanti Polar Lipid Inc., (Alabaster USA).
+ Open protocol
+ Expand
4

Synthesis and Evaluation of CFTR Modulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
The molecules, 2a, 7a, and 7m, were synthetised, as previously published [37 (link),38 (link)]. The known CFTR modulators, Tezacaftor, VX661, Elexacaftor, VX445 and Ivacaftor, and VX770 were purchased from Selleck Chemicals (Munich, Germany). If not explicitly indicated in the text, all other chemicals and culture media components were provided by Merck (Milan, Italy).
+ Open protocol
+ Expand
5

Cystic Fibrosis Therapeutic Compound Evaluation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lumacaftor (VX-809) and Ivacaftor (VX-770) were purchased from Selleckchem via ThermoFisher (Pittsburgh, PA); collagen and bovine serum type1 were obtained from Corning (Bedford, MA), Fibronectin and MQAE dye were purchased from Life Technology (Eugene, OR); SYBR® green PCR master mix was obtained from Applied Biosystems (Warrington, UK); PCR custom primers hQCF3 GACAGTTGTTGGCGG TTGCT (sense) and hQCF4 ACCCTCTGAAGGCTCCAGTTC (Antisense) were synthesized by Invitrogen (Carlsbad, CA); procirol AT05 (glycerol distearate) GATTEFOSSE, sequalene, and span 85 were purchased from Sigma (Sant-Louis, MO); tween 80 and polyethylene glycol (PEG 2000) were purchased from Avanti Polar Lipid Inc., (Alabaster USA).
+ Open protocol
+ Expand
6

Cystic Fibrosis Drug Compounds Assessment

Check if the same lab product or an alternative is used in the 5 most similar protocols
Polymyxin B (Catalogue number 81334, ≥6,500 IU/mg) was purchased from Sigma-Aldrich (Australia). Ivacaftor, lumacaftor and VX-661 were purchased from (SelleckChem, USA). All other reagents were purchased from Sigma-Aldrich (Australia) and are of the highest commercial grade available.
+ Open protocol
+ Expand
7

Protein Modulator Screening Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Twenty-four hours after seeding, cells were treated with BTZ (Selleckchem), CFZ (Selleckchem), MG132 (Selleckchem), givinostat (Selleckchem), belinostat (Selleckchem), tubacin (Selleckchem), Lumacaftor (VX-809; Selleckchem), Ivacaftor (VX-770; Selleckchem) or the carrier 0.1% dimethyl sulfoxide (DMSO, VWR). Cells were analyzed after 24 h of treatment.
+ Open protocol
+ Expand
8

Synthesis and Characterization of TMA Analogs

Check if the same lab product or an alternative is used in the 5 most similar protocols
lumacaftor and ivacaftor were obtained by Selleckchem (United States), TMA and TMA analogs were partly synthesized as previously described (Guiotto et al., 1984 (link), 1995 (link); Marzaro et al., 2018 (link)) and partly belong to the collection of the Organic Synthesis Lab (Department of Pharmaceutical Sciences, University of Padova). DMA was newly synthesized as described in the Supplementary Material. TMA and TMA analogs were dissolved in DMSO at a final concentration of 200 μM (stock solution), whereas lumacaftor and ivacaftor were dissolved in DMSO at a final concentration of 10 mM.
+ Open protocol
+ Expand
9

Neutrophil-Mediated Antimicrobial Killing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human or mouse neutrophils (5×105) were infected with Burkholderia cenocepacia (Bc), Pseudomonas aeruginosa (Pa01), Staphylococcus aureus (Sa) or Nontypeable Haemophilus influenzae (NTHI) using a multiplicity of infection of 10 (MOI=10) in RPMI medium with 2% FBS for 45 minutes. Cells were centrifuged at 1200 rpm for 7 minutes, the supernatant was removed, and the pellet was resuspended and seeded in 24 well plates, then some neutrophils were treated with 3×10−6 M of EGTA (Sigma Aldrich, St. Louis, MO) or 10−5 M of 2-APB (Sigma Aldrich, St. Louis, USA) and incubated for 3 hours at 37 °C. Some samples were pretreated with 10−5 M DPI for 10 minutes or with or with 5×10−6 M of VX-770 (Ivacaftor, Selleckchem.com) for 60 minutes at 37 °C and maintained with the potentiator during the course of infection. To quantify intracellular bacteria, neutrophils were lysed with 0.1% Triton X-100 (Sigma Aldrich, St. Louis, MO), and free bacteria were quantified by serial dilution on LB and chocolate agar plates. Relative percent of antimicrobial killing was calculated by dividing the inverse CFU of CF with non-CF neutrophils and multiplied by 100.
+ Open protocol
+ Expand
10

CFTR Modulator Compounds Comparison

Check if the same lab product or an alternative is used in the 5 most similar protocols
Isobutylmethyl xanthine
(IBMX) and isoproterenol
(Isop) were purchased from Sigma (St. Louis, MO). The following compounds
were kindly provided by R. Bridges (Rosalind Franklin University,
Chicago, IL) and The Cystic Fibrosis Foundation (CFF): 4-[4-oxo-2-thioxo-3-(3-trifluoromethylphenyl)thiazolidin-5-ylidenemethyl]-benzoic
acid (CFTRinh-172 or CF172), 2-[(2-1H-indol-3-ylacetyl)methylamino]-N-(4-isopropylphenyl)-2-phenyl-acetamide (PG-01 or P2),
and 4-methyl-2-(5-phenyl-1H-pyrazol-3-yl)-phenol
(VRT-532 or P1). Genistein was purchased from TCI America (Portland,
OR). N-(2,4-Di-tert-butyl-5-hydroxyphenyl)-4-oxo-1,4-dihydroquinoline-3-carboxamide
(VX-770 or Ivacaftor) was purchased from Selleck Chemicals (Houston,
TX).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!