Kod plus neo

Genomic DNA was individually prepared from embryos at more than 3 days post-fertilization (dpf). Each embryo was lysed in 25 μL of alkaline lysis buffer containing 25 mM NaOH and 0.2 mM ethylenediaminetetraacetic acid (EDTA) (pH 8.0) and incubated at 95 °C for 15 min after being broken with forceps. The lysate was neutralized with 25 μL of 40 mM Tris-HCl (pH 8.0) and used as the genomic DNA. Heterozygous/homozygous genotypes were identified using the HMA [22 (link),23 (link),24 (link)] and/or nucleotide sequence analysis. A 296-bp fragment containing the entire genomic target sequence of the alveolin gene was amplified using the primers ALV-exon-3-F (CCTGGGTCTATGCTGTGCTATG) and ALV-exon-3-R (CTGCAAGAACCCACCTTTACC). The reaction mixture contained 1 µL of genomic DNA as a template, 1× polymerase chain reaction (PCR) buffer for KOD-Plus-Neo, 0.2 mM of each dNTP, 1.5 mM of MgSO₄, 0.2 µM of each primer, and 0.02 unit of KOD-Plus-Neo (TOYOBO) in a total volume of 10 µL. The cycling conditions were as follows: one cycle at 94 °C for 2 min, followed by 35 cycles at 98 °C for 10 s, 67.5 °C for 30 s, and 68 °C for 8 s. The resulting amplicons were electrophoresed on either 15% polyacrylamide gels or 2% agarose gels. Alternatively, the PCR amplicons were sequenced using ALV-exon-3-F as a primer.

A portion of λDNA (NIPPON GENE CO., LTD, Japan) was duplicated by PCR amplification using a biotin-modified forward primer and a biotin-unmodified reverse primer to obtain biotin-modified 400-bp dsDNA. PCR amplification was performed using MiniAmp Plus Thermal Cyclers (Thermo Fisher Scientific, Waltham, MA). Both ssDNA and primer were purchased from Sigma Aldrich, Japan. The sequences of the forward and reverse primers were 5′-TGCAACGAACAGGTCACTATCA-3′ and 5′-GAGCAAAGCAAAACAGGCGTA-3′, respectively. PCR amplification was performed in 50-μL reaction volumes consisting of 0.3 μM forward primer, 0.3 μM reverse primer, 50 ng λDNA, 1 U KOD-Plus- Neo, 1X PCR buffer for KOD -Plus- Neo, 0.2 mM dNTPs, and 1.5 mM MgSO₄ (TOYOBO CO., LTD., Japan). The cycling parameters of PCR were 94 °C for 2 min → [98 °C for 10 sec → 58 °C for 30 sec → 68 °C for 30 sec] × 35 times. The product obtained after PCR was purified using NucleoSpin® Gel and PCR Clean-up (Takara Bio Inc., Japan). The purified product was then quantitated with a Qubit fluorometric system (Life Technologies). A biotin-streptavidin binding reaction was performed in 18.3-μL reaction volumes consisting of 1.5 μM biotin-modified dsDNA and 10 μM streptavidin. The time and temperature of the binding reaction were 37 °C and 30 min, respectively.