Genomic DNA was extracted directly from each sample using the PowerSoilTM DNA isolation kit (MoBio, USA), according to the manufacturer’s instructions. The V1-V3 hypervariable region of the 16S gene was PCR amplified using universal primers described previously28 (link) and sequenced on a 454 GS-FLX Titanium platform (Roche). Forward primers incorporated GS Titanium adapters as well as a sample-specific barcode sequences. Raw sequence data have been deposited in the NCBI Sequence Read Archive under accession number SRP059769.
454 gs flx titanium platform
Manufactured by Roche
Sourced in United States, Germany, Switzerland
The Roche 454 GS FLX+ Titanium platform is a next-generation sequencing system designed for high-throughput DNA sequencing. It utilizes pyrosequencing technology to generate long sequencing reads, enabling researchers to study complex genomic regions and perform de novo sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Axyprep dna gel extraction kit, by Corning (7 mentions)
Quantifluor st, by Promega (6 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Powerwater dna isolation kit, by Qiagen (1 mentions)
Hotstartaq master mix, by Qiagen (1 mentions)
Q5 buffer, by New England Biolabs (1 mentions)
Axyprep mag pcr clean up kit, by Corning (1 mentions)
Dna 7500 chip, by Agilent Technologies (1 mentions)
2100 bioanalyzer, by Agilent Technologies (1 mentions)
Nd 2000 spectrometer, by Thermo Fisher Scientific (1 mentions)
Dntps, by Takara Bio (1 mentions)
Agarose gel dna purification kit, by Takara Bio (1 mentions)
Ex taq, by Takara Bio (1 mentions)
Newbler assembler, by Roche (1 mentions)
Prepman ultra reagent, by Thermo Fisher Scientific (1 mentions)
Abi 3130xl genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator cycle sequence kit v 3, by Thermo Fisher Scientific (1 mentions)
Primestar hs dna polymerase, by Takara Bio (1 mentions)
Faststart hifi polymerase, by Roche (1 mentions)
Picogreen, by Thermo Fisher Scientific (1 mentions)
44 protocols using 454 gs flx titanium platform
1
16S Ribosomal Gene Sequencing from Soil
2
Amplification and Sequencing of Eukaryotic 18S rRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted using a PowerWater DNA isolation kit (MO BIO Laboratories, Inc., Carlsbad, CA, USA). Extracted DNA samples were processed by Research and Testing Laboratories (Lubbock, TX, USA). The V-4 fragments of 18S rRNA genes were amplified with TAReuk454FWD1 and TAReukREV3 (see Table S1 in the supplemental material). Amplifications were performed in 25-μl reaction volumes with recombinant Hot Start Taq polymerase (Qiagen HotStarTaq master mix; Qiagen, Inc., Valencia, CA, USA), 1 μl of each 5 μM primer, and 1 μl of template on ABI Veriti thermocyclers (Applied Biosytems, Carlsbad, CA, USA) under the following thermal profile: 95°C for 5 min, followed by 10 cycles of 94°C for 30 s, 57°C for 45 s, and 72°C for 1 min and then 25 additional cycles of 94°C for 30 s, 45°C for 45 s, and 72°C for 1 min, and a final 2-min extension at 72°C (51 (link)). As the reverse primer TAReukREV3 poorly targets haptophytes, we additionally sequenced samples with high haptophyte abundance (23 May to 30 July) using the reverse primer HaptoR1 (Table S1 ) under the following thermal profile: 95°C for 5 min, followed by 35 cycles of 94°C for 30 s, 55°C for 45 s, and 72°C for 1 min, and a final 2-min extension at 72°C (55 (link)). The amplicons were sequenced using the Roche 454 GS FLX Titanium platform with an average sequencing depth of 10,000 raw reads per sample.
3
Gut Microbiome Profiling of Pachysoma spp.
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gut metagenomic DNA of five individuals (equal concentrations of combined hindgut and midgut-derived DNA) from each Pachysoma spp. was sent to Molecular Research (www.mrdnalab.com ) for 16S rRNA gene and ITS gene region pyrosequencing using the Roche 454 GS FLX titanium platform. The primers 27F (AGRGTTTGATCMTGGCTCAG; [91 ]) and 338R (AGTGCTGCCTCCCGTAGGAGT; [92 ] were used to amplify the 16S rRNA gene region as they have a low eukaryotic coverage (27F: 0%; 338R: [93 ]). Fungal specific fITS9 (GAACGCAGCRAAIIGYGA; [94 (link)]) and ITS4 (TCCTCCGCTTATTGATATGC; [95 (link)]) primers were used for the amplification of the ITS gene region.
4
Multiplexed DNA Sequencing on 454 Platform
5
454 GS FLX Titanium cDNA Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA fragments of A. gigas were sequenced in the 454 GS FLX Titanium platform (Roche, Branford, CT, USA). The emulsion PCR (emPCR) was based on the enrichment, purification and preparation of the Pico Titer Plate (PTP), which were conducted according to the manufacturer’s instructions. All the libraries were sequenced four times and each run used a PTP with two regions. Raw reads data that support the findings of this study have been deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) database: (Bioproject: PRJNA353913/SRX2375194, SRX2375196, SRX2375197, and SRX2375191 ).
6
Amplification and Sequencing of Bacterial 16S rRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Universal primers were used to target the SSU rRNA gene within the V6-8 region of Bacteria [32 (link)]. Barcodes (TCB 2009–005) added were from the extended MID set (Roche, Branford, Connecticut, USA). PCR reactions contained: 1X Q5 buffer (New England Biolabs, Ipswich, Massachusetts, USA), 200 μM of each dNTP (Feldan, Quebec, Quebec, Canada), 0.2 μM of each 454 primer (IDT), 1 U of Q5 High-Fidelity DNA polymerase (NEB), and 1 μL of template DNA (10–50 ng). Cycling conditions were as follows: an initial denaturation at 98°C for 30 s, followed by 30 cycles of denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and a final extension at 72°C for 5 min. PCR products were purified using the Axyprep Mag PCR Clean-up Kit (Axygen, Union City, California, USA), and verified with a Bioanalyzer 2100 with DNA 7500 chips (Agilent Technologies, Santa Clara, California, USA). PCR products were then quantified with a NanoDrop 2000 spectrophotometer (Thermo Scientific). The 12 sample-coded amplicons were mixed in equal quantity and 1/8th plate was sequenced on a Roche 454 GS-FLX Titanium platform at the Plate-forme d’Analyses Génomiques de l’Université Laval (Québec, QC, Canada).
7
Chloroplast genome sequencing of A. kravanh
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fresh A. kravanh leaves were collected from cultivated fields in Hainan Province, China. Total chloroplast DNA (cpDNA) was extracted from approximately 100 g of leaves using the sucrose gradient centrifugation method, as improved by Li et al. (2012) [25 ]. The concentration of cpDNA was estimated by measuring A260 and A280 using an ND-2000 spectrometer (Nanodrop Technologies, Wilmington, DE, USA); samples were also visually examined by gel electrophoresis. Pure cpDNA was used to construct shotgun libraries, which were sequenced by Herbgenomics Technologies on the 454 GS FLX Titanium platform (Roche Diagnostics, Basel, Switzerland), according to the manufacturer’s instructions. The resulting sff-file was pre-processed by trimming low-quality (Q < 20) and short (L < 50 bp) reads. This resulted in about 60× coverage of this cp genome. Cleaned reads were used for sequence assembly using GS FLX De Novo Assembler Software (Newbler V2.6). To verify the assembly, the four junctions between the inverted repeat (IR) and long single-copy/short single-copy (LSC/SSC) regions were confirmed by PCR amplification and Sanger sequencing.
8
Fungal ITS rDNA Amplification and Pyrosequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR amplification of the fungal internal transcribed spacer (ITS) rDNA genes from genomic DNA was performed with barcoded primers. The bacterial forward primer was ITS1F (CTTGGTCATTTAGAGGAAGTAA), and the reverse primer was ITS2 (GCTGCGTTCTTCATCGATGC). PCR was performed in a 20 μL reaction mixture containing 1 μL of DNA template (10 ng/μL), 0.4 μL of each primer (10 pmol), 0.15 μL of Ex Taq (TaKaRa), 2 μL of 10x buffer, 1.6 μL of dNTPs (2.5 mM) (TaKaRa), and 13.5 μL of ddH2O. Cycling conditions were as follows: initial denaturation at 98°C for 2 min, followed by 35 cycles of 98°C for 15 s, 56°C for 30 s, and 72°C for 40 s, with a final extension at 72°C for 10 min. PCR products were purified using the TaKaRa Agarose Gel DNA Purification kit and quantified with a NanoDrop. A mixture of purified ITS rDNA amplicons from each soil sample was subjected to pyrosequencing on the 454 GS FLX titanium platform (Roche, Basel, Switzerland) at the National Human Genome Centre of China (Shanghai).
9
Extraction and Sequencing of Bacterial DNA from Lake Cadagno
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Water samples were filtered onto 0.2 μm cellulose-nitrate membrane filters (Sartorius Stedim Biotech, Goettingen, Germany). Each filter was then inserted into a small plastic envelope. Three mL of TE (Tris-EDTA) buffer were added and bacterial cells were resuspended by manually rubbing the filter. The supernatant containing the bacterial cells was then transferred into another envelope. This procedure resulted in samples of concentrated microbial cells in TE buffer solution from the three layers of Lake Cadagno water column.
Total DNA was then extracted from the supernatant through proteinase K and extraction protocol based on phenol/chloroform optimized for the extraction of DNA from bacterial plankton [33 ]. DNA concentrations ranged from 77 to 149 ng/μL. For each sample, around 1000 ng of DNA was sent to an external laboratory (Research and Testing Laboratory (LCC) in Lubbock, Texas, USA) for pyrosequencing (454 GS FLX Titanium platform; 454 Life Sciences, Roche, Branford, USA). The primers used for the amplification of 16S rRNA genes were28F (5’-GAG TTT GAT CNT GGC TCA G-3’) and 519R (5-GWA TTA CCG CGG CKG CTG-3’) allowing the recovery of short fragments of approximately 400 bp in the 16S rRNA gene that included the V1-V3 hypervariable regions.
Total DNA was then extracted from the supernatant through proteinase K and extraction protocol based on phenol/chloroform optimized for the extraction of DNA from bacterial plankton [33 ]. DNA concentrations ranged from 77 to 149 ng/μL. For each sample, around 1000 ng of DNA was sent to an external laboratory (Research and Testing Laboratory (LCC) in Lubbock, Texas, USA) for pyrosequencing (454 GS FLX Titanium platform; 454 Life Sciences, Roche, Branford, USA). The primers used for the amplification of 16S rRNA genes were
10
Genomic DNA Extraction and Whole-Genome Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from the isolates was extracted using PrepMan Ultra Reagent (Applied Biosystems) according to the manufacturer’s instructions. Whole-genome shotgun sequencing was performed on a 454 GS FLX Titanium platform (Roche Diagnostics) [10 (link)]. Bases sequenced and corresponding quality values were called and delivered in standard format by GS FLX for downstream bioinformatic analyses. Sequence reads were assembled de novo using Newbler assembler (Roche Diagnostics).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!