Camptothecin

Manufactured by Merck Group

Sourced in United States, Germany, United Kingdom, Belgium, Sao Tome and Principe, France, Macao, Poland

Camptothecin is a naturally occurring alkaloid compound isolated from the Camptotheca acuminata tree. It is a biologically active compound with potential applications in research and development. Camptothecin exhibits inhibitory effects on the enzyme topoisomerase I, which is involved in DNA replication and transcription processes. This property makes Camptothecin a valuable tool for studying cellular mechanisms and biological processes.

Automatically generated - may contain errors

Lab products found in correlation

Etoposide, by Merck Group (49 mentions) Cisplatin, by Merck Group (28 mentions) Hydroxyurea, by Merck Group (22 mentions) Doxorubicin, by Merck Group (22 mentions) Dimethyl sulfoxide (dmso), by Merck Group (21 mentions) Propidium iodide, by Merck Group (14 mentions) Aphidicolin, by Merck Group (12 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (11 mentions) Cycloheximide (chx), by Merck Group (10 mentions) Olaparib, by Selleck Chemicals (9 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (9 mentions) Staurosporine, by Merck Group (8 mentions) Mitomycin c, by Merck Group (8 mentions) Streptomycin, by Merck Group (8 mentions) Actinomycin d, by Merck Group (8 mentions) Streptomycin, by Thermo Fisher Scientific (7 mentions) 5 fluorouracil, by Merck Group (7 mentions) Paclitaxel, by Merck Group (7 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (7 mentions) Penicillin, by Thermo Fisher Scientific (6 mentions)

330 protocols using camptothecin

Evaluating Epigenetic Modulators on Neuroendocrine Tumor Cell Proliferation and Apoptosis

Check if the same lab product or an alternative is used in the 5 most similar protocols

CNDT2.5 (2 × 10⁵) and KRJ-I (1 × 10⁵) cells were transfected with PTPRM expression vector (ViGene) or empty vector (pEnter) as described earlier, and after 72 h, the same number of cells for all the samples were distributed in a 96-well plate and cell proliferation was followed for 24 h. Then, cell proliferation was measured by the CyQUANT cell proliferation assay kit (Invitrogen, Thermo Fisher Scientific) according to the manufacturer’s instruction. The cells were stained with CyQuant GR dye solution and fluorescence intensity was measured at 480/520 nm using Infinite 200 PRO (TECAN) plate reader. The Cell Death Detection ELISA kit (Roche Molecular Biochemicals) was used to measure apoptosis, as determined by quantifying cytoplasmic histone-associated-DNA-fragments, 72 h after transfection according to the manufacturer’s protocol. As a positive control, CNDT2.5 and KRJ-I cells were incubated with 0.1 µg/mL camptothecin (Sigma Aldrich) for 48 h and the reported values were calculated as a ratio of value/positive control (camptothecin) × 100.
CNDT2.5 (2 × 10⁵) and KRJ-I (1 × 10⁵) cells were treated with the 5-aza-2′-deoxycytidine or the 3-deazaneplanocin A (DZNep, Merck) as described earlier. After 72 h, cell proliferation and apoptosis were measured as mentioned above.

Barazeghi E., Hellman P., Westin G, & Stålberg P. (2019). PTPRM, a candidate tumor suppressor gene in small intestinal neuroendocrine tumors. Endocrine Connections, 8(8), 1126-1135.

+ Open protocol

+ Expand

Evaluating Cytotoxicity and Apoptosis in Rat Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Rat skin fibroblasts FR (ATCC® CRL1213™) were seeded in 96-well plates at 1 × 10⁵ cells/mL and allowed to reach log phase growth. On day four, complete growth media was aspirated. In initial studies, 100 μl of one of the following treatments were added: 0, 0.00002, 0.0002, 0.002, 0.02, 0.2, 2, 20, 200 or 500 μM concentrations of DON (Sigma-Aldrich) or the positive control 6 μM camptothecin (Sigma-Aldrich) in OptiMem (Invitrogen) with 3% FBS. Following a one, two, four or six-hour incubation, the treatments were aspirated and the cells were assessed for differences in apoptosis and cell viability. For later studies, 100 μl of the following treatments were added: 0, 2, 20, or 200 μM concentrations of DON (Sigma-Aldrich) and the positive control 6 μM camptothecin (Sigma-Aldrich) in OptiMem (Invitrogen) 3% FBS. Following forty-eight hours incubation, the treatments were aspirated and the cells were assessed for differences in apoptosis and cell viability. The Annexin V FITC assay kit (Cayman Chemical 600300) was used to detect apoptosis and cell viability. Absorbance and fluorescence were read at 485nm excitation/535nm emission. Results were obtained using a Multimode Detector DTX 880 (Beckman Coulter).

Crosby H.A., Ihnat M, & Miller K.E. (2015). Evaluating the Toxicity of the Analgesic Glutaminase Inhibitor 6-Diazo-5-Oxo-L-Norleucine in vitro and on Rat Dermal Skin Fibroblasts. MOJ toxicology, 1(1), 00005.

+ Open protocol

+ Expand

Evaluating Cell Viability and Apoptosis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were treated with bafilomycin A1 (10 nM; Sigma‐Aldrich), z‐VAD‐FMK (20 μM; R&D Systems, Minneapolis, MN) and/or Torin‐1 (5 or 10 μM; Tocris/Bio‐Techne Ltd, Abingdon, OX, UK). All treatments were performed for 24 hr, except bafilomycin A1 for 6 hr. As control experiments, we included cells treated with DMSO or camptothecin (100 μM; Sigma‐Aldrich) and a combination of camptothecin (100 μM) and z‐VAD‐FMK (20 μM). For cell viability assay, 10 μl of WST‐1 reagent (Roche Diagnostics, Indianapolis, IN) was added into each well and incubated for 2 hr. Measurements were recorded at wavelengths 450 nm (WST‐1 cleavage products) and 690 nm (reference) using VERSAmax microplate reader (Molecular Devices, Sunnyvale, CA) and analyzed with SoftMax Pro 7 (Molecular Devices). Five replicate wells were included for each treatment group. Relative cell viability in each treatment was normalized to DMSO‐treated group. All experiments were repeated three times independently. Cell apoptosis was evaluated using Annexin V‐FITC apoptosis kit (#640905; BioLegend, San Diego, CA). All staining conditions were performed according to the manufacturer's instructions and analyzed by NovoCyte flow cytometer (ACEA Biosciences, San Diego, CA). All experiments were repeated four times independently.

Kumar S., Xie H., Shi H., Gao J., Juhlin C.C., Björnhagen V., Höög A., Lee L., Larsson C, & Lui W. (2019). Merkel cell polyomavirus oncoproteins induce microRNAs that suppress multiple autophagy genes. International Journal of Cancer, 146(6), 1652-1666.

+ Open protocol

+ Expand

Quantitative HPLC Analysis of Camptothecin

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Twenty microliter of the extract sample was injected in a reverse phase HPLC (LC-20AD, Shimadzu, Japan) at a flow rate of 0.8 ml/ min using 25% acetonitrile as the mobile phase. ODS Hypersil gold column (Thermo Scientific) with a particle size of 5 µm was used as the stationary phase at a temperature of 30 °C. Absorbance of camptothecin was measured at 254 nm by a photodiode array detector^{10 (link)}. Concentration of camptothecin in the sample was estimated using a standard plot of area vs. known concentration of camptothecin, generated using authentic samples of camptothecin (> 95% purity, Sigma Aldrich, St. Louis, MO, USA ).

Mohinudeen I.A., Pandey S., Kanniyappan H., Muthuvijayan V, & Srivastava S. (2021). Screening and selection of camptothecin producing endophytes from Nothapodytes nimmoniana. Scientific Reports, 11, 11205.

+ Open protocol

+ Expand

Camptothecin Treatment of NCI-H358 Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

NCI-H358 human bronchioalveolar non-small cell carcinoma cells (H358), catalogue number CRL-5907, were purchased in May 2011 from the American Type Culture Collection and were mycoplasma-free. Cells were grown at 37°C in 10% CO₂ in Dulbecco’s Modified Eagles Medium supplemented with 10% newborn calf serum and additives, as previously described [8 (link)]. For camptothecin treatment, cells were incubated for 24 hours in the presence of 0.1 or 1 μM camptothecin (Sigma, St. Louis, MO), followed by harvesting and Western analysis as described below.

Zhao M, & Gjerset R.A. (2015). Topoisomerase-I PS506 as a Dual Function Cancer Biomarker. PLoS ONE, 10(8), e0134929.

+ Open protocol

+ Expand

METTL3 Depletion and Camptothecin Treatment in HEK293T

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T cells (ATCC) were cultured at 37°C using DMEM supplemented with 10% FBS. METTL3-depleted cell lines were generated by cloning a METTL3-targeting sgRNA sequence (5’- GGAGTTGATTGAGGTAAAGCG -3’) into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (a gift from Feng Zhang; Addgene plasmid # 62988; http://n2t.net/addgene:62988). Plasmids were then transfected into HEK293T cells and stable cells were selected with puromycin. Validation of METTL3 depletion was performed with western blot, RNA-Seq, and m⁶A immunoblotting. Camptothecin treatment was carried out for 5 hours at 37°C using 6μM final concentration of Camptothecin (Sigma) from a 3mM stock prepared in DMSO. Control cells were treated with the same volume of DMSO.

, & Meyer K.D. (2019). DART-seq: an antibody-free method for global m6A detection. Nature methods, 16(12), 1275-1280.

+ Open protocol

+ Expand

Apoptosis Evaluation in Insect Cells and Haemocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Apoptosis was evaluated by flow cytometric analysis of Annexin V and Propidium Iodide (PI)-stained cells using fluorescein isothiocyanate (FITC) Annexin V Apoptosis Detection kit I (Becton Dickinson, Biosciences, San Jose, CA, USA). The assay was carried out on S2 cells (negative control), on S2 cells stably expressing TnBVank1 and on H. virescens haemocytes after TnBVank1 in vivo transfection and after parasitism. S2 cells and polyclonal S2 cells were used in passages 4–10. For the positive control, apoptosis was induced by treating the cells with 1 μM camptothecin, a cytotoxic alkaloid inhibitor of Topoisomerase I, known to induce apoptosis^{50 (link),51 (link)} (Sigma-Aldrich St Louis, MO, USA), or injecting into haemocoel of larvae directly 1 μM camptothecin for 20 h^{34 (link)}. As negative control for the in vivo assay, H. virescens haemocytes after injection of the vector pIZT/V5-His without TnBVank1 were used. Cell samples were washed twice and incubated with Annexin V-FITC/PI for 15 min as manufacturer’s protocol. Stained samples were acquired using Navios flow cytometer and analysed by Kaluza Analysis 1.3 software (Beckman Coulter). Single positive for Annexin V and double positive for Annexin V and PI cells were interpreted as signs of early and late phases of apoptosis respectively.

Salvia R., Grossi G., Amoresano A., Scieuzo C., Nardiello M., Giangrande C., Laurenzana I., Ruggieri V., Bufo S.A., Vinson S.B., Carmosino M., Neunemann D., Vogel H., Pucci P, & Falabella P. (2017). The multifunctional polydnavirus TnBVANK1 protein: impact on host apoptotic pathway. Scientific Reports, 7, 11775.

+ Open protocol

+ Expand

Anticancer Drug Treatment of Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human cervical cancer cell lines (HeLa and C-4I) and ovarian cancer cell lines (OVCAR-3 and TOV-21G) were originally obtained from the American Type Culture Collection (ATCC). All four cell lines were authenticated with the DNA markers used by ATCC. Our cell lines were all stocked mycoplasma free in liquid nitrogen tanks and used for experiments for 4-5 months with at least one additional test for mycoplasma. The mycoplasma-free cultures were maintained in RPMI 1640 medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS) and 0.1% penicillin in 5% CO₂ at 37°C. For drug treatment, cisplatin, doxorubicin, paclitaxel, and camptothecin were purchased from Sigma and dissolved in water (cisplatin) or dimethylsulfoxide (DMSO) (doxorubicin, paclitaxel and camptothecin). Their aliquots were stored at -80°C.

Zhu H., Gu X., Xia L., Zhou Y., Bouamar H., Yang J., Ding X., Zwieb C., Zhang J., Hinck A.P., Sun L.Z, & Zhu X. (2018). A Novel TGF-β Trap Blocks Chemotherapeutics-Induced TGF-β1 Signaling and Enhances Their Anticancer Activity in Gynecological Cancers. Clinical cancer research : an official journal of the American Association for Cancer Research, 24(12), 2780-2793.

+ Open protocol

+ Expand

METTL3 Depletion and Camptothecin Treatment in HEK293T

Check if the same lab product or an alternative is used in the 5 most similar protocols

, & Meyer K.D. (2019). DART-seq: an antibody-free method for global m6A detection. Nature methods, 16(12), 1275-1280.

+ Open protocol

+ Expand

Lentivirus-Mediated CRISPR Screening for Chemosensitivity

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were transduced at low MOI (<1.0) with lentivirus derived from pLentiGuide (RPE1 cells) or pLentiCRISPRv2 (DLD1 cells), which expressed sgRNAs targeting CIP2A, TOPBP1 or AAVS1 (which was used as control). Puromycin-containing medium was added the next day to select for transductants and cells were seeded for clonal growth 48 h later. Cells were seeded in 10-cm dishes (750-5,000 cells per 10 cm plate, depending on cell line and genotype, 125nM AS1 was additionally added in the media for expression of DD-EGFP-CIP2A). For drug sensitivity assays, cells were seeded into media containing a range of camptothecin (Sigma) concentrations (for determination of camptothecin sensitivity) or in regular media after several days of AS1 treatment (i.e. after induction of FLAG or GFP-B6L). For clonogenic survival assays performed with CIP2A -/-cells, plates were incubated in atmospheric oxygen. Experiments performed with BRCA1 -/-and BRCA2 -/-cells and their controls were incubated at 3% O2. . Medium was refreshed after 7 d. After 14-20 d, colonies were stained with a crystal violet solution (0.4% (w/v) crystal violet (Sigma), 20% methanol). Colonies were manually counted or counted using a GelCount instrument (Oxford Optronix). Data were plotted as surviving fractions relative to untreated cells or sgAAVS1-transduced controls.

Adam S., Rossi S.E., Moatti N., De Marco Zompit M., Xue Y., Ng T.F., Álvarez-Quilón A., Desjardins J., Bhaskaran V., Martino G., Setiaputra D., Noordermeer S.M., Ohsumi T.K., Hustedt N., Szilard R.K., Chaudhary N., Munro M., Veloso A., Melo H., Yin S.Y., Papp R., Young J.T.F., Zinda M., Stucki M, & Durocher D. (2021). The CIP2A-TOPBP1 axis safeguards chromosome stability and is a synthetic lethal target for BRCA-mutated cancer. Nature cancer, 2(12).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!