Normal goat serum (ngs)

Genome sequencing was performed by MicrobesNG (Birmingham) by Illumina NGS with a coverage of 30%. The reads were trimmed using Trimmomatic (Bolger et al., 2014 (link)) and de novo assembly was performed using SPAdes 3.7 (Bankevich et al., 2012 (link)). Annotation was undertaken using the NCBI Prokaryotic Genome Annotation Pipeline (PGAP) v4.10 (Tatusova et al., 2016 (link)).
Average Nucleotide Identity (ANI) using MUMmer (Delcher et al., 2003 (link)) as the alignment algorithm (ANIm) or BLAST (ANIb) was calculated using the JSpeciesWS package (Richter and Rosselló-Móra, 2009 (link)). Pairwise comparisons were made between the genome sequences of the strains Re CFN42^T (accessions CP000133.1–CP000138.1, U80928.5), Rp ATCC 14482^T (accessions RJJV01000001–RJJV01000081) and Rlv UPM791 (accessions CP025505.1–CP025510.1) using a custom BLAST database on Geneious 10.0.9 (Biomatters). Clusters of orthologous groups (COGs) of proteins were predicted using the WebMGA server (Wu et al., 2011 (link)) and KAAS (KEGG Automatic Annotation Server) for the functional annotation of genes (Moriya et al., 2007 (link)). BLAST Ring Image Generator (BRIG) software was used to display circular genome comparisons (Alikhan et al., 2011 (link)).
The draft of this whole-genome shotgun project has been deposited in GenBank under the provisional accession no WNKD00000000.

RNA was extracted from C4–2B MDVR cells treated with 2.5 and 5 μM JG98 for 24 h. RNA-seq libraries from 1 μg of total RNA were prepared using the Illumina Tru-Seq RNA Sample according to the manufacturer’s instructions. The mRNA-Seq paired-end library was prepared using Illumina NGS on a HiSeq 4000:2 × 150 cycles/bases (150 bp, PE). Around 30 M of reads/sample were obtained. Data analysis was performed using a Top Hat-Cufflinks pipeline and sequence read mapping/alignment was performed using HISAT. StringTie Data were mapped and quantified for 27,044 unique genes/transcripts. Gene and transcript expression was quantified as FPKM (Fragments Per Kilobase of transcript per million mapped reads). Principal Component Analysis (PCA) was conducted on the FPKM gene-level data for all genes/transcripts that passed the filter (Filtered on Expression > 1, ∣ log2 ((FKPM₁ +0.1)/(DMSO+0.1),2) ∣ > 0.25, and kept 0→values and values→0) in the Raw Data. The genes commonly regulated by JG98 treatments were clustered with the Hierarchical Clustering algorithm using the R.

Cas9⁺dsRed⁺MLL-AF9 leukemia cells were transduced with lentiviral Cxcr4 sgRNA vectors coexpressing GFP and cultured for 3 days. Sorting of GFP⁺ cells was performed by flow cytometry followed by genomic DNA isolation. The binding regions of Cxcr4 sgRNA_a and Cxcr4 sgRNA_b were PCR amplified using the primer pairs 5′TCCACAGGCTATCGGGGTAA3′, 5′GTGACGTTGTCTGTCCCTGT3′ and 5′ATCTGTGACCGCCTTTACCC3′, 5′TCCTGCCTAGACACTCATTCAC3′, followed by amplicon tagmentation prior to NGS (Illumina). CRISPR-mediated DNA editing was quantified using the bioinformatics tool TIGERq (TIGERq, Lund, Sweden).

Reserved MDA products were reanalyzed by NGS (Illumina) for comprehensive chromosomal screening. The span between MDA and reanalysis by NGS was within 3 years. Karyotype profiles were scored independently by two analysts using MiSeq Reporter software (Illumina), which depicts the copy number variation (CNV) for each chromosome in a sample. CNV values less than 1.20 or greater than 2.80 were labeled monosomy or trisomy; CNV values between 1.80 and 2.20 were considered euploid; and aneuploidies with CNV values between 1.20 and 1.80 or between 2.20 and 2.80 were considered mosaicism. Chaotic embryos were defined as those showing a complex pattern of aneuploidies involving more than six chromosomes [18 (link)]. Genomic referrence for sequence alignment is hg19. All personnel analyzing the biopsies were blinded to the clinical outcomes.

We also retrieved the SARS-CoV-2 VOC Delta sequences obtained from Bangladesh to compare their evolutionary pattern with that of Omicron. In total, we obtained 2,811 high-quality genomes of SARS-CoV-2 Delta from Bangladesh, of which 1,437 were sequenced via Illumina next-generation sequencing. Following quality control of the sequences and removal of redundant sequences as described previously, we selected 442 unique and clean sequences of the S gene from SARS-CoV-2 Delta found in Bangladesh. The selected sequences were subjected to codon-based alignment and analyzed via codon-substitution models. Furthermore, we also compiled all the SARS-CoV-2 Omicron genomes reported from West Bengal, India. In total, 6,506 SARS-CoV-2 Omicron sequences have been reported from West Bengal, India, sequenced via Illumina NGS. Sc2rf software identified 227 of these SARS-CoV-2 Omicron genomes as potential recombinants and, thus, were removed from the analysis. After quality control and duplicate removal, we found 460 clean and unique sequences of the S gene isolated from SARS-CoV-2 Omicron found in West Bengal, India.