Total RNA was extracted from murine myocardial tissues and H9c2 cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Subsequently, RNA was reverse transcribed into first-strand cDNA using the PrimeScript RT Master Mix (Takara Bio, Inc.) according to the manufacturer's instructions. qPCR was performed using the SYBR Premix ExTaq Kit (Takara Bio, Inc.) using the ABI PRISM 7900 Real-Time System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The thermocycling conditions were as follows: initial denaturation at 95°C for 30 sec; 40 cycles of denaturation at 95°C for 5 sec, annealing at 60°C for 30 sec and extension at 72°C for 60 sec. The program was terminated via final extension at 72°C for 1 min and cooling at 40°C. The primer sequences used for qPCR were as follows: CTRP12 F, 5′-CCTGTCCTTGGGCCGATTTA-3′ and R, 5′-CAGGGACGTATGACGGTGAC-3′; KLF15 F, 5′-GGGATCGTGGAGGAGAGCCT-3′ and R, 5′-CCAGCTGAGAGCTGGCTACA-3′; and GAPDH F, 5′-GTCAAGGCTGAGAACGGGAA-3′ and R 5′-AAATGAGCCCCAGCCTTCTC-3′. The mRNA expression levels were quantified using the 2−ΔΔCq method and were normalized using the internal reference gene GAPDH (29 (link)).
Abi prism 7900 real time system
Manufactured by Thermo Fisher Scientific
Sourced in United States, Japan
The ABI PRISM 7900 Real-Time system is a quantitative real-time PCR instrument designed for high-throughput gene expression analysis. The system utilizes TaqMan probe-based detection technology to quantify nucleic acid targets in a sample.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
Primescript rt master mix, by Takara Bio (7 mentions)
Sybr premix ex taq kit, by Takara Bio (6 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Rnaeasy mini kit, by Qiagen (1 mentions)
Primescript rt master mix perfect real time, by Takara Bio (1 mentions)
Sybr green master mix system, by Bio-Rad (1 mentions)
Human lncrna microarray v3, by Arraystar (1 mentions)
Primescript rt regent kit, by Takara Bio (1 mentions)
Primescript rt master mix perfect real time kit, by Takara Bio (1 mentions)
Trizol solution, by Takara Bio (1 mentions)
Trizol reagent, by Qiagen (1 mentions)
Primescript rt reagent kit, by Bio-Rad (1 mentions)
Sybr prime script rt pcr kits, by Takara Bio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Primescript 2 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Sybr green qpcr kit, by Takara Bio (1 mentions)
15 protocols using abi prism 7900 real time system
1
Quantitative Real-Time PCR Analysis
2
Quantifying MACC1 Expression Using RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was obtained from NCI-H520, A549, H358 and MRC-5 cells prior or the tumor tissues with Chanti-MACC-1 by using RNAeasy Mini kit (24 (link)) (Qiagen Sciences, Inc., Gaithersburg, MD, USA). A total of 1 µg total RNA was then transcribed into cDNA using the PrimeScript™ RT Master mix (Perfect Real Time; Takara Biotechnology Co., Ltd.) in an ABI PRISM 7900 real time system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The quality of the synthetic cDNA was verified by electrophoresis. Subsequently, the synthetic cDNA (10 ng) was subjected to RT-qPCR using SYBR-Green Master Mix system (Bio-Rad Laboratories, Inc). The protocol of thermos cycling was as follows: Denaturation, 95°C for 2 min; annealing, 40 repetitions of 95°C for 30 sec and 60°C for 60 sec; and final extension, 72°C for 10 min. The primers used in the present study were synthesized by Shanghai Shenggong Biology Engineering Technology Service, Ltd., Shanghai, China. MACC-1 forward, 5′-AGTGGGATTGTGGAGACGGTGT-3′ and reverse, 5′-AGGTAAAAGGAACTGGCAACGC-3′; GAPDH forward, 5′-GTGGACATCCGCAAAGAC-3′ and reverse, 5′-AAAGGGTGTAACGCAACTA-3′. GAPDH was included as an internal control. Differences in mRNA expression alterations were calculated by 2−ΔΔCq (25 (link)). The results are expressed as the n-fold way compared with control.
3
Comprehensive lncRNA and mRNA Profiling via Microarray
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Arraystar human lncRNA microarray V3.0 (Array-Star, Rockville, MD, USA) contains the transcripts from authoritative public transcription database, and was designed for the global profiling of human lncRNAs and mRNAs. The microarray work was completed by KangChen Bio-tech (Shanghai, China).
QRT-PCR was performed to determine the relative expression levels of lncRNAs and genes. Primescript RT regent kit (TaKaRa, Dalian, Japan) was used for the reverse transcriptase (RT) reaction. In brief, the RT reaction was performed for 15 minutes at 37°C, followed by 5 seconds at 85°C and 1 minute at 4°C with Prime Script RT Master Mix. The qRT-PCR was performed to quantify the expression of lncRNAs using an ABI Prism 7900 Real-Time System (Applied Biosystems, Foster City, CA, USA) with SYBR Premix Ex Taq (Takara). The primers used in the qRT-PCR were designed by Ribo Bio-tech (Guangzhou, China) and are shown inTable 2 . β-actin was used as an internal control. The data were analyzed using the 2−ΔΔCt (∆∆Ct = [mean Ct value of lncRNA – mean Ct value of β-actin] in the AECOPD or stable COPD subjects – mean value [mean Ct value of lncRNA – mean Ct value of β-actin] in the control subjects) method and presented as relative expression level.
QRT-PCR was performed to determine the relative expression levels of lncRNAs and genes. Primescript RT regent kit (TaKaRa, Dalian, Japan) was used for the reverse transcriptase (RT) reaction. In brief, the RT reaction was performed for 15 minutes at 37°C, followed by 5 seconds at 85°C and 1 minute at 4°C with Prime Script RT Master Mix. The qRT-PCR was performed to quantify the expression of lncRNAs using an ABI Prism 7900 Real-Time System (Applied Biosystems, Foster City, CA, USA) with SYBR Premix Ex Taq (Takara). The primers used in the qRT-PCR were designed by Ribo Bio-tech (Guangzhou, China) and are shown in
4
Quantification of Tim-3 Expression in Human Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the human tissues and cultured cells were extracted using TRIzol solution (Takara Biotechnology Co., Ltd., Dalian, China) and quantified using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). A 1 µg sample of mRNA was reverse transcribed using PrimeScript RT Master Mix (Perfect Real Time) kit (Takara Biotechnology Co., Ltd.) and qPCR was performed in an ABI PRISM 7900 Real Time system (Applied Biosystems; Thermo Fisher Scientific, Inc.) using the SYBR Premix Ex Taq kit (Takara Biotechnology Co., Ltd.). The primers used were as follows: Tim-3, forward 5′-GCTACTACTTACAAGGTCCTCAG-3′ and reverse 5′-ATTCACATCCCTTTCATCAGTC-3′; GAPDH, forward 5′-GTGGACATCCGCAAAGAC-3′ and reverse 5′-AAAGGGTGTAACGCAACTA-3′. U Initial denaturation was performed at 95°C for 30 sec, and PCR by 40 cycles of 95°C for 5 sec and 60°C for 35 sec. All experiments were performed in triplicate at least three times. Values were calculated used the 2−ΔΔCq method (25 (link))
5
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the treated splenocytes was extracted using TRIzol reagent (Qiagen, Hilden, Germany) and quantified using the Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). For the detection of mRNA, 2 μg of total RNA was reversely transcribed into cDNA using PrimeScript RT reagent Kit (Bio-Rad, Hercules, CA, USA). Subsequently, RT-PCR was performed with SYBR Prime Script RT-PCR Kits (TaKaRa, Otsu, Shiga, Japan) on an ABI PRISM 7900 Real-Time system (Applied Biosystems, Foster City, CA, USA), with GAPDH as an endogenous control. The reaction protocol was as follows: denaturation at 95 °C for 10 min, followed by 40 cycles of denaturation 95 °C for 30 s, annealing at 60 °C for 1 min and extending at 72 °C for 30 s. The relative gene expression was calculated using the 2−∆∆Ct method.
6
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from human tissues and cultured gastric cancer cells using TRIzol® reagent (Takara Biotechnology Co., Ltd., Dalian, China), according to the manufacturer's protocols. The RNA quality and concentration were determined by collecting the absorbance with the Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). Reverse transcription (RT) of first-strand cDNAs (1 µg) was performed using PrimeScript RT Master mix (Takara Biotechnology Co., Ltd.), according to the manufacturer's protocol. All PCR amplifications were performed in an ABI PRISM 7900 Real-Time system (Applied Biosystems; Thermo Fisher Scientific, Inc.) with the SYBR® Premix Ex Taq™ kit (Takara Biotechnology Co., Ltd.). The thermocycling conditions were as follows: Initial denaturation at 95°C for 5 min, followed by 45 repeats of a three-step cycling program consisting of 10 sec at 95°C (denaturation), 10 sec at 60°C (primer annealing) and 10 sec at 72°C (elongation), and a final extension step for 10 min at 72°C. The primer sequences used for qPCR are listed in Table I and GAPDH was used as the internal control. Primers were synthesized by Shanghai Shenggong Biology Engineering Technology Service, Ltd. (Shanghai, China). All quantitative data were normalized to GAPDH using the 2−ΔΔCq method (14 (link)).
7
Quantifying KIFC1 Expression in OS Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Utilizing TRIzol reagent (Invitrogen, Shanghai, China), total RNA was extracted from treated OS cells (1 × 105) before cDNA synthesis with PrimeScript II 1st Strand cDNA Synthesis Kit (Takara, Shanghai, China). Then, qRT-PCR was carried out by ABI PRISM 7900 Real-Time system (Applied Biosystems, Foster City, CA, USA) with the SYBR Premix Ex Taq II (Takara). The relative expression was calculated with the 2−ΔΔct method compared to GAPDH. The following primers were used for qRT-PCR: KIFC1 forward (5′-3′): TGAGCAACAAGGAGTCCCAC and reverse (5′-3′): TCACTTCCTGTTGGCCTGAG, and GAPDH forward (5′-3′): CATGAGAAGTATGACAACAGCCT and GAPDH reverse (5′-3′): AGTCCTTCCACGATACCAAAGT.
8
Quantification of Epithelial-Mesenchymal Transition Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were pretreated with 20μM OA for 24 h. Total RNA was extracted by TRIzol (Invitrogen, Carlsbad, CA) reagent. The purity and quality of RNA were examined by NanoDrop2000 (Thermo Scientific, Wilmington, DE). Total RNA was reversely transcribed into cDNA using the Reverse Transcription System Kit (Takara; Dalian, China). Then Quantitative real-time PCR was carried out using SYBR green qPCR kit (TakaraBio, Inc.) on an ABI PRISM 7900 Real-Time system (Applied Biosystems, Foster City, CA, USA). The PCR amplification program was the following: 95°C for 20 sec, followed by 40 cycles of 95°C for 1 sec and 60°C for 20 sec. The sequences of PCR primers were listed as follows: E-cadherin (forward: 5′-CCACCAAAGTCACGCTGAAT-3′, reverse: 5′-GGAGTTGGGAAATGTGAGC-3′), N-cadherin (forward: 5′-GTGCCATTAGCCAAGGAATTCAGC-3′, reverse: 5′-GCGTTCCTGTTCCACTCATAGGAGG-3′), Vimentin (forward: 5′-ATGAAGGTGCTGCAAAAC-3′, reverse: 5′-GTGACTGCACCTGTCTCCGGTA-3′), GAPDH (forward: 5′-ATG AGCCCCAGCCTTCTCCAT-3′, reverse: 5′-GGTCGGAGTCAACGGATTTG-3′). mRNA level was expressed as the relative change after normalized versus GAPDH. Relative expression was quantified by the 2−ΔΔCq method [17 (link)]. The expression levels were relative to the fold change of the controls, which were defined as 1.0.
9
RNA Extraction and Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from cultured cells by TRIzol reagent (Life technology, USA). The purity of total RNA was assessed with A NanoDrop 3000 spectrophotometer (Thermo Scientific, Waltham, MA) at the wavelength of 260 and 280 nm. Then, the RNAs were reversely transcribed into cDNA using PrimeScript RT Master Mix (Takara, Japan) and PCR amplification was performed with the SYBR Premix ExTaq kit (Takara, Japan) in an ABI PRISM 7900 Real-Time system (Applied Biosystems, USA). The PCR amplification program was as follow: 94°C for 60 sec, followed by 40 cycles of 94°C for 30 sec, 60°C for 30 sec and 72°C for 60 sec. Primer sequences were as follows:
All expression data were normalized to the expression of GAPDH.
All expression data were normalized to the expression of GAPDH.
10
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from transfected or untransfected cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). RNA was reverse transcribed into first-strand cDNA using the PrimeScript RT Master Mix (Takara Bio, Inc.). cDNA was amplified using a SYBR PrimeScript RT-PCR kit (Takara Bio, Inc.) in an ABI PRISM 7900 Real-Time system (Applied Biosystems, Foster City, CA, USA). The PCR program was 95°C for 3 min, followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 30 s and extension at 72°C for 1 min. A final extension step at 72°C for 7 min was performed in each PCR assay. The primer sequences for PCR are presented as below: TMEM100, 5ʹ-TACCGAGCTCTCCTGCTACC-3ʹ (forward) and 5′-CCAGGCCAAAGATGGAGATA-3′ (reverse); GATA5, 5ʹ- AGTGCGAGCGGGACACGGTT-3′ (forward) and 5′-GAGCACTCACCAGCGGGCAG-3′(reverse); GAPDH: 5′-GGGAAACTGTGGCGTGAT-3′ (forward) and 5′-GAGTGGGTGTCGCTGTTGA-3′ (reverse). The relative expression levels of the target genes were normalized to GAPDH and calculated using the 2−ΔΔCq method [20 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!