The largest database of trusted experimental protocols

Lentiviral packaging mix

Manufactured by Merck Group
Sourced in United States

Lentiviral packaging mix is a laboratory reagent used for the production of lentiviral particles. It contains the necessary viral components required for the packaging of lentiviral genetic material into infectious viral particles. The mix enables the efficient generation of lentiviral vectors, which can be used for various applications in cell biology and gene therapy research.

Automatically generated - may contain errors

29 protocols using lentiviral packaging mix

1

Generation of GNAQ Knockdown Lentivirus

Check if the same lab product or an alternative is used in the 5 most similar protocols
Short hairpin (shRNA) (5′-CCGGCTATGATAGACGACGAGAATACTCGAGTATTCTCGTCGTCTATCATAGTTT TTG-3′) against human GNAQ (NM_002072.4) and a control (SHC002) shRNA were purchased from Sigma-Aldrich (USA). The recombinant GNAQ silencing and control plasmid were transfected into 293 T cells using a lentiviral packaging mix (Sigma-Aldrich) and Lipofectamin2000 according to the manufacturer’s protocol. After transfection for 48 hours, the lentiviral supernatant was harvested and the lentiviral particles were used to infect the A549 cells.
+ Open protocol
+ Expand
2

TGFβ1-Induced Signaling Pathway Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant human TGFβ1 was purchased from Cell Signaling Technology (Beverly, MA, USA) and was solubilized in sterile 20 mM citrate (pH.3.0). SFN was obtained from Sigma-Aldrich (Saint Louis, MO, USA). Antibodies recognizing pSMAD2, pSMAD3, SMAD7, and SMURF1 were from Cell Signaling Technology. β-Tubulin and ATF3 antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The luciferase reporter plasmid containing the ARE was a gift from Dr. Nobuano Wakabayashi (University of Pittsburg, PA, USA) [34] (link). The reporter plasmid containing the human SMAD-responsive element (SRE) was obtained from Addgene (Cambridge, MA, USA). The lentiviral expression plasmids for human NRF2 and KEAP1 short hairpin RNA (shRNA), lentiviral packaging mix, hexadimethrine bromide, and puromycin were from Sigma-Aldrich. Reagents for GSH measurement, including NADPH, GSR, and GSH, were obtained from Sigma-Aldrich.
+ Open protocol
+ Expand
3

HSD10 Knockdown in HEK 293T and PC-12 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK 293 T cells (ATCC® CRL-11268; 2.5 × 105 cells/well in a 6-well plate) were transfected with HSD10 shRNA (HSD17B10 MISSION® shRNA Bacterial Glycerol Stock, Human, SHCLNG NM_004493.2-751s21c1 TRCN0000318938, Sequence: CCGGCATCGAGAACCCATTCCTCAACTCGAGTTGAGGAATGGGTTCTCGATGTTTTTG; Sigma-Aldrich) or control shRNA (MISSION® TRC2 pLKO.5-puro Non-Mammalian shRNA Control Plasmid DNA, SHC202; Sigma-Aldrich) using Lipofectamine 2000 and Lentiviral Packaging Mix. Cell media was harvested at 36 and 72 hours post-transfection. PC-12 cells (105 cells/well in a 12-well plate) were infected with HSD10 shRNA and non-mammalian shRNA media over 10 days with continual passaging, and then were maintained in RPMI-1640 medium supplemented with 10% horse serum and 5% FBS in a humidified 37°C, 5% CO2 incubator, with shRNA viral media added to cell cultures once a week.
+ Open protocol
+ Expand
4

Lentiviral Transduction of shRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral particles expressing shRNAs were produced in 293T cells according to the manufacturers’ instructions. Briefly, Lenti-XTM 293T cells were transfected with lentiviral packaging mix (Sigma) and MISSION pKLO.1 plasmid containing non-targeting shRNA (shNONtg) or pooled ARID1A shRNAs (shARID1A) (Sigma) using polyethylenimine (PEI) in DMEM + 4.5 g/L d-Glucose, 110 mg/L Sodium Pyruvate, 10% FBS, 1% l-glutamine. After 4 h, media was replaced with DMEM/F12, 10% FBS, 1% L-glutamine, 1% P/S. Viral particles were collected after 48 and 96 h, and viral titers were calculated using the qPCR Lentiviral Titration Kit (ABM).
+ Open protocol
+ Expand
5

Generating Notch3 Knockdown Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate stable Notch3 knockdown (KD) cell lines using lentiviral vector, Notch3 shRNA and control lentiviral particles were generated in HEK293T cells by co-transfecting Notch3 shRNA or scrambled shRNA plasmids (Mission® shRNA, Sigma-Aldrich, St. Louis, MO) and lentiviral packaging mix (Sigma-Aldrich) using Lipofectamine 2000 (Invitrogen, Waltham, MA) according to manufacturer’s instruction. Notch3 stable KD cell lines were achieved by infecting cells with lentiviral particles and followed by selection in puromycin-containing medium (1 μg/ml for 1205Lu; 2 μg/ml for A375 and WM852).
+ Open protocol
+ Expand
6

Silencing ZEB2 in SNU-398 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
ZEB2-specific siRNA (5′-CAACAUAUCCACUCCAUUU-3′) and scrambled siRNA (5′-AUUCUAUCCAAUACCUACC-3′) were subcloned into the pLKO.1 lentiviral shRNA vector (Addgene, Cambridge, MA, USA) to generate pLKO.1-shZEB2 and pLKO.1-shscrambled according to the manufacturer’s instructions. To generate lentiviruses, pLKO.1-shZEB2 or pLKO.1-shscrambled was co-transfected with Lentiviral Packaging Mix (Sigma) into Lenti-X-293T cells (Clontech) using Lipofectamine 2000, and virus-containing supernatants were harvested and concentrated at 48 h post-transfection. SNU-398 cells were transduced with the lentiviruses for 12 h in the presence of polybrene (4 µg/ml) and were subsequently selected with puromycin (0.7 µg/ml) for 2 weeks to establish stable clones.
+ Open protocol
+ Expand
7

Overexpression and knockdown of GRHL2 and ZEB1 in cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
GRHL2-targeting shRNA (TRCN0000015810 and TRCN0000015812) and negative control plasmids—Luciferase shRNA and non-targeting shRNA (SHC007, SHC016) were purchased from Sigma. Plasmids were incubated with Lentiviral Packaging Mix (SHP001, Sigma) and Fugene 6 (Roche) before addition to 293T cells. Viral supernatants were harvested to infect cells with the addition of 8 μg/ml polybrene (Sigma). After 48 h, infected cells were selected by puromycin (4 to 7 μg/ml). For ZEB1 overexpression, plasmid pCMV6-AC-GFP-ZEB1 generated from pCMV6-Entry-ZEB1 (RC217704, Origene) was used. Transfected cells were selected by G418 (Life Technologies) at 300 μg/ml, and three single clones (one ZEB1-low, two ZEB1-high) were picked. For GRHL2 overexpression, pLenti-GIII-CMV-GFP-2A-Puro was purchased from Applied Biological Materials. shRNA-resistant GRHL2* with four silent mutations was generated using Quick Change II XL Site-Directed Mutagenesis kit (Stratagene). For overexpression of mature miRNAs, microRNA mimics (HMC0002, HMI0357, HMI0350, HMI0352, HMI0359; Sigma) were transfected into cells by HiPerfect® transfection reagent (Qiagen).
+ Open protocol
+ Expand
8

Lentiviral Transduction for Gene Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviruses were produced by co-transfection HEK293LTX cells with the MISSION® TRC2 pLKO.5-puro Non-Mammalian shRNA Control Plasmid DNA or with the pLKO-puro shRNA constructs (Sigma, shRNA sequences are available in Table S3) and the Lentiviral Packaging Mix (psPAX2 and pMD2.G). U2OS and NCIH1975 cells were transduced by the lentivirus, and cells with stable knockdowns were selected using puromycin (2 μg/ml for U2OS and 1 μg/ml for NCIH1975). The knockdown of RUNX1 and SNAI1 in stable cell lines was confirmed by quantitative real-time PCR.
+ Open protocol
+ Expand
9

Efficient Lentiviral Particle Production in 96-well Format

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cell suspensions at 20,000 cells per well were dispensed into 96-well microtiter plates (Corning 3603) in 100 μL of media and incubated overnight at 37°C. The Lentiviral Packaging Mix (Sigma-Aldrich) containing the packaging plasmid and envelope plasmid were thawed from −20°C storage at room temperature in preparation for transfection. A master mix containing 16.5 μL of Opti-Mem (Life Technologies), 0.3 μL or 0.6 μL of FuGENE 6 and HD transfection reagent (Promega) diluted to 0.75 μL, and 1 μL of Lentiviral Packaging Mix was dispensed into an intermediate 96-well polypropylene storage plate (Corning 3357) containing 0.1 μg of expression plasmid and incubated for 15 minutes to promote plasmid-transfection reagent complex formation. Next, 20 μL was transferred into the cell plates and incubated for 48 h at 37°C. For the first harvest, 85 μL of lentiviral supernatant was transferred into an intermediate 96-well storage plate and stored at 4°C. Cell plates were replenished with 85 μL of media and incubated for an additional 24 h at 37°C. For the second harvest, 95 μL of lentiviral supernatant was transferred into the corresponding intermediate storage plate already yielding a total harvest of lentiviral particles in 180 μL. Plates were briefly centrifuged at 1,000 rpm to remove any cell debris and aliquots of lentiviral supernatants were stored at −80°C.
+ Open protocol
+ Expand
10

Lentiviral Particle Production in HEK 293T

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral particles were produced in HEK 293T cells following the transfection of the cells with the relevant shRNA expression plasmid (Sigma-Aldrich) and lentiviral packaging mix (Sigma Aldrich) as described previously [46] (link). Briefly, HEK 293T cells were seeded in 60-mm plates at a density of 7.0×105 cells/well. The next day, the medium was replaced with Opti-MEM (Invitrogen, Carlsbad, CA, USA) and, subsequently, 1.5 μg pLKO.1-NRF2 shRNA, (5′-CCGGGCTCCTACTGTGATGTGAAATCTCGAGATTTCACATCACAGTAGGA-3′) or pLKO.1-KEAP1 shRNA (5′-CCGGGTGGCGAATGATCACAGCAATCTCGAGATTGCTGTGATCATTCGCCACTTTTTTG-3′) and the packaging mix were transfected into the cells by using Lipofectamine 2000 (Invitrogen). As a nonspecific RNA, the pLKO.1-scrambled (sc) RNA plasmid was transfected in the control group. On the second day, the medium containing the transfection complex was removed. The medium containing lentiviral particles was harvested after 4 days.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!