Log In Sign up
The largest database of trusted experimental protocols

Typhoon fluorescence imager

Manufactured by GE Healthcare
Visit Supplier
Sourced in United States, Canada

The Typhoon fluorescence imager is a versatile imaging system designed for a variety of life science applications. It utilizes fluorescence detection technology to capture high-quality images of labeled samples, such as electrophoresis gels, microarrays, and blots. The Typhoon imager features multiple excitation wavelengths and can accommodate a range of sample formats, allowing researchers to analyze a wide variety of biological samples.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop one, by Thermo Fisher Scientific (2 mentions) Sypro ruby, by Thermo Fisher Scientific (1 mentions) Las4000, by GE Healthcare (1 mentions) Bca protein kit, by Thermo Fisher Scientific (1 mentions) Odyssey blocking buffer, by LI COR (1 mentions) Ripa lysis and extraction buffer, by Thermo Fisher Scientific (1 mentions) Mini protean tgx precast gel, by Bio-Rad (1 mentions) Rna century plus marker template and maxiscript t7transcription kit, by Thermo Fisher Scientific (1 mentions) S4utp, by TriLink (1 mentions) Turbo dnase, by Thermo Fisher Scientific (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Dynabeads myone streptavidin c1 beads, by Thermo Fisher Scientific (1 mentions) Nucleotidecleanup kit, by Qiagen (1 mentions) Dy547, by Horizon Discovery (1 mentions)

Close spelling variants of this product

Typhoon Trio Fluorescence imager Typhoon FLA 9500 Fluorescence Imager Typhoon 9500 fluorescence imager Typhoon imager

9 protocols using typhoon fluorescence imager

1

Quantification of Smooth Muscle Actin

Check if the same lab product or an alternative is used in the 5 most similar protocols
hASMCs plated in 12 or 24 well plates, were fixed with 4% paraformaldehyde, permeabilized with 0.5% Triton X-100, blocked with 1% bovine serum albumin (BSA) for 1 hour, and incubated overnight with Cy3-conjgated SM α-actin antibody in 1% BSA at 4°C. Cellular DNA content was quantitated using SYBR green (AB systems) after incubation for 1 hour at room temperature. Cells were washed with PBS and plates were imaged using a Typhoon fluorescence imager (GE Healthcare) after each incubation. Fluorescence was quantitated using ImageJ analytical software, and the ratio of α-actin to SYBR green detection was determined for each well of the plate.
Adedoyin O.O, & Loftin C.D. (2016). Microsomal Prostaglandin E Synthase-1 Expression by Aortic Smooth Muscle Cells Attenuates the Differentiated Phenotype. Journal of cardiovascular pharmacology, 68(2), 127-142.
+ Open protocol
+ Expand
2

Protease Visualization in Cultured Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Samples were collected and sonicated (1 min on ice) in citrate buffer (50mM Citrate buffer pH 5.5, 5 mM DDT, 0.5% CHAPS, 0.1% Triton X). After centrifugation at 4 degree C for 30 min, the supernatants were collected, and protein concentration was determined using a BCA kit (pierce). Protein (40 µg total) was denatured in SDS-sample buffer for 2 min at 100 °C and analyzed. Samples were resolved by SDS-PAGE (15%) and labeled proteases were visualized by scanning the gel with a Typhoon fluorescence imager (GE Healthcare).
Segal E., Prestwood T.R., van der Linden W.A., Carmi Y., Bhattacharya N., Withana N., Verdoes M., Habtezion A., Engleman E.G, & Bogyo M. (2015). Detection of Intestinal Cancer by local, topical application of a Quenched Fluorescence Probe for Cysteine Cathepsins. Chemistry & biology, 22(1), 148-158.
+ Open protocol
+ Expand
3

Crosslinking and SDS-PAGE Analysis of Eca Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols
Crosslinking in detergent was performed by adding 0.125% glutaraldehyde to Eca at P:D ratio of 1.7 × 10−3, and it was quenched through the addition of 90 mM Tris (pH 8.0). Samples were analyzed by SDS-PAGE stained with Coomassie Blue. Crosslinking of the F177C Eca in liposomes (oxidized samples) was performed by adding 0.075 mM oxidized glutathione and 1.4 mM reduced glutathione to the proteoliposomes. Samples were freeze–thawed 3× and were incubated at 22 °C for 3 days. The reaction was quenched with 17 mM N-ethylmaleimide prior to SDS-PAGE analysis. Reduced samples were treated with 50 mM tris(2-carboxyethyl)phosphine prior to analysis. SDS-PAGE loading buffer contained no reducing agent, with a final SDS concentration of 2%. Gel was stained with SYPRO Ruby (Invitrogen) and was visualized via Typhoon fluorescence imager (GE Healthcare).
Last N.B, & Miller C. (2015). Functional Monomerization of a ClC-Type Fluoride Transporter. Journal of molecular biology, 427(22), 3607-3612.
+ Open protocol
+ Expand
4

Fluorescent Protein Visualization by SDS-PAGE

Check if the same lab product or an alternative is used in the 5 most similar protocols
SNAPf-tagged proteins derivatized with fluorophores were visualized by denaturing polyacrylamide gel electrophoresis (SDS-PAGE) followed by imaging fluorescence on a LAS 4000 or Typhoon fluorescence imager (GE Life Sciences).
Larson J.D, & Hoskins A.A. (2017). Dynamics and consequences of spliceosome E complex formation. eLife, 6, e27592.
+ Open protocol
+ Expand
5

Western Blot Analysis of Intracellular Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
After 2–6 h of infection time, flasks were washed three times with cold 1XHBSS to remove non-adherent sporozoites and oocysts. Cells were lysed and solubilized using RIPA lysis and extraction buffer (Life Technologies, Inc., Carlsbad, CA) supplemented with Halt protease and phosphatase inhibitor cocktail (100X) (Life Technologies, Inc). Lysates were clarified by centrifugation at 13,000xg for 10 min at -9˚C, followed by quantification using BCA Protein Kit (Life Technologies, Inc.). Proteins were resolved by SDS-PAGE using 4–15% Mini-PROTEAN® TGX™ precast gels (BioRad, Hercules, CA), and transferred onto a low fluorescence PVDF membrane. The membranes were then blocked by incubation in Odyssey Blocking Buffer (Li-Cor, Inc., Lincoln, NE) for 1 h followed by incubation with the appropriate antibody diluted in the blocking buffer overnight. Detection was done using ECL Plex Cy3 or Cy5 conjugate secondary antibodies (GE Healthcare, Noblesville, IN), followed by excitation with a Typhoon Fluorescence Imager (GE Healthcare). Generated images were quantified using Image J software. Experiments were performed on at least three separate occasions.
Varughese E.A., Kasper S., Anneken E.M, & Yadav J.S. (2015). SHP-2 Mediates Cryptosporidium parvum Infectivity in Human Intestinal Epithelial Cells. PLoS ONE, 10(11), e0142219.
+ Open protocol
+ Expand
6

Enrichment and Visualization of Synthetic RNA

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
1 μg of total RNA from HEK293T cells was combined with 1 ng total RNA from S. pombe and enriched with MTS biotin exactly as in (29 (link)) or with MTS-resin as above. Enriched samples were assayed by RT-qPCR as above and fold enrichment was calculated as

An RNA ladder of 100–1000 nt was transcribed in vitro using the RNA Century Plus Marker Template and Maxiscript T7 transcription kit (Invitrogen) using Cy5-CTP at a ratio of 1:1 Cy5-CTP:CTP for downstream visualization, with the option of adding s4UTP (TriLink Biotechnologies) at a ratio of 1:1 s4UTP:UTP to the reaction. After the reaction, template DNA was digested with Turbo DNase (Thermo Fisher). Enzymes were removed by phenol-chloroform extraction and the RNA was purified using the RNeasy Mini Kit (QIAGEN) with the following changes: β-mercaptoethanol was added to wash buffer RPE to a final concentration of 1%. 400 ng of RNA ladder was enriched with MTS-resin following the protocol described above, or with HPDP-biotin and MTS-biotin following protocols in (18 (link)). Enriched samples were separated on a 5% urea-PAGE gel, visualized by Typhoon fluorescence imager (GE), and bands were quantified using ImageJ software.
Duffy E.E., Canzio D., Maniatis T, & Simon M.D. (2018). Solid phase chemistry to covalently and reversibly capture thiolated RNA. Nucleic Acids Research, 46(14), 6996-7005.
+ Open protocol
+ Expand
7

s4U Enrichment and Purification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Two fluorescently labeled RNAs were synthesized for s4U
enrichment: non-s4U 39-nt RNA (DY647 -
GGAACCGCCCGGAUAGUGUCCUUGGGAAACCAAGUCCGGGCACCA) and one s4U 39-nt RNA
(DY547 - GGAACCGCCCGGA(s4U)AGUGUCCUUGGGAAACCAAGUCCGGGCACCA)
(Dharmacon). Biotinylation reactions (50 μL total) contained RNA (1
μM), 10 mM HEPES [pH 7.5], 1 mM EDTA, and 25 μM
MTS- or HPDP-biotin (dissolved in DMF at 250 μM). Reactions were
incubated at room temperature in the dark for 30 min or 2 hr, respectively.
Following biotinylation, excess biotinylation reagenets were removed with two
consecutive chloroform washes, followed by purification with a nucleotide
cleanup kit (Qiagen) according to the manufacturer’s instructions.
Biotinylated RNA was separated from non-labeled RNA using Dynabeads MyOne
Streptavidin C1 beads (Invitrogen). Biotinylated RNA was incubated with 50
μL Dynabeads with rotation for 1 hr at room temperature in the dark.
Beads were magnetically fixed and washed twice with Dynabeads high salt wash
buffer. s4U-RNA was eluted with 100 μL of elution buffer (10
mM Tris [pH 7.4] and 100 mM DTT). Fractions were concentrated by
ethanol precipitation, separated on a 12% urea-PAGE gel, and visualized
by Typhoon fluorescence imager (GE).
Duffy E.E., Rutenberg-Schoenberg M., Stark C.D., Kitchen R.R., Gerstein M.B, & Simon M.D. (2015). Tracking distinct RNA populations using efficient and reversible covalent chemistry. Molecular cell, 59(5), 858-866.
+ Open protocol
+ Expand
8

Protein Expression Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were lysed in boiling buffer56 and then sonicated; the protein concentration was measured on a NanoDrop One (Thermo Fisher Scientific), and then the volume was adjusted to bring the concentration to a consistent level across all samples. Total proteins were separated by SDS‐PAGE, and then the protein imprints were transferred to a PVDF membrane and blocked in 5% skim milk at room temperature for 1 h. The membrane was incubated overnight with the primary antibody at 4°C and then incubated with the secondary antibody for 3 h. ECF developing reagent (RPN5785, GE Healthcare, Boston, MA, USA) was diluted at the appropriate ratio with TBS, and the membrane was scanned on a Typhoon fluorescence imager (GE Healthcare).
Chang Y., Jin H., Li H., Ma J., Zheng Z., Sun B., Lyu Y., Lin M., Zhao H., Shen L., Zhang R., Wu S., Lin W., Lu Y., Xie Q., Zhang G., Huang X, & Huang H. (2020). MiRNA‐516a promotes bladder cancer metastasis by inhibiting MMP9 protein degradation via the AKT/FOXO3A/SMURF1 axis. Clinical and Translational Medicine, 10(8), e263.
+ Open protocol
+ Expand
9

Profiling Lipid Hydrolase Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols
Prewarmed leukocyte suspensions (37°C, 2 × 10 7 cells/ml) in HBSS containing 1.6mM CaCl 2 were incubated with DMSO, MAFP (10 μM), or JZL184 (10 μM) for 10 min. FP-TAMRA (3 μM) was then added for 30 min, and incubations were stopped using two volumes of ice-cold HBSS before transferring the samples in an ice-water bath. Samples were centrifuged (4°C, 350 × g, 5 min) and cell pellets were lysed and denatured using the same procedure as for immunoblots. Samples were loaded on a polyacrylamide gel, migrated and FP-TAMRAstained proteins were visualized using a Typhoon fluorescence imager (GE Healthcare, Toronto, ON, Canada). Enzyme sensitivity for the inhibitors was assessed by comparing the TAMRA fluorescence intensity with that of a labeled control without inhibitors.
Turcotte C., Dumais É., Archambault A.S., Martin C., Blanchet M.R., Bissonnette É., Boulet L.P., Laviolette M., Di Marzo V, & Flamand N. (2019). Human leukocytes differentially express endocannabinoid-glycerol lipases and hydrolyze 2-arachidonoyl-glycerol and its metabolites from the 15-lipoxygenase and cyclooxygenase pathways. Journal of leukocyte biology, 106(6).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!