The largest database of trusted experimental protocols

31 protocols using γ 32p atp

1

Radiolabeling and Binding Assay for TAR RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Refolded synthetic TAR (nucleotides 18–44) was radioactively labeled with 32P-γ–ATP using T4-polynucleotide kinase. A 10-µl reaction was prepared with 200 nM TAR, 0.3 mCi 32P-γ–ATP (7000 Ci/mmol, MP Biomedicals, Sohon, OH), and 10 units of T4-polynucleotide kinase (New England BioLabs, Ipswich, MA) in 70 mM Tris/HCl pH7.6, 10 mM MgCl2, 2 mM DTT. After incubating at 37°C for 1 hr, 25 µl of annealing buffer (20 mM Na HEPES pH 7.3, 100 mM KCl, 3 mM MgCl2) were added to the reaction. The mixture was purified twice over Illustra G25 spin columns (GE Healthcare, Piscataway, NJ) to remove free nucleotides. The purified labeled TAR was diluted to 10 nM (3000–5000 cpm/ µl) with annealing buffer for storage and use in EMSAs.
Binding reactions (10 µl) were carried out in 20 mM Na HEPES pH 7.3, 100 mM KCl, 3 mM MgCl2, 1 mM DTT, 4% glycerol with 12 units RNasin (Promega, Madison, WI), 10 µg/ml BSA, and 5 µg/ml poly(I:C) (Invivogen, San Diego, CA). Each reaction contained 100 pM labeled TAR RNA. Reactions were incubated at 20°C for 30 min and RNA-binding complexes were separated on a pre-run 6% polyacrylamide gel in 0.5x TBE (100 V, 1 hr at 4°C). Gels were dried, exposed to storage phosphor screens, and measured on a Typhoon phosphorimager (GE Healthcare, Piscataway, NJ).
+ Open protocol
+ Expand
2

Biochemical Assays and Reagents

Check if the same lab product or an alternative is used in the 5 most similar protocols
2,4,6-THBA, 3,4-DHBA, 3,4,5-THBA, 4-HBA and trypsin-EDTA were obtained from Sigma Aldrich (St. Louis, MO, USA); H1 Histones and Immobilon membranes from EMD Millipore (Billerica, MA, USA); 32P γ-ATP from MP Biochemicals (Solon, OH, USA); RT-PCR reagents from New England Biolabs (NEB, Ipswich, MA, USA); qPCR reagents from Applied Biosystems (Foster City, CA, USA); Annexin V/7-AAD kit from Beckman Coulter (Miami, FL, USA); Super Signal™ West Pico Chemiluminescent Substrate, protease inhibitor tablets and all other chemicals were obtained from Thermo Fisher Scientific, Inc. (Waltham, MA, USA).
+ Open protocol
+ Expand
3

Immunoblotting of Phosphorylated Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary antibodies (Ab) used in this study were monoclonal αHA from Covance, polyclonal αpPAK1(Thr423)/PAK2(Thr402) from Cell Signaling, polyclonal αRARα and polyclonal αpaxillin from Santa-Cruz Biotechnology, Inc. Prolactin was purchased from Dr. Parlow (National Hormone and Peptide Program, NIDDK), 17β-estradiol (E2) from Sigma-Aldrich, [γ-32P]ATP from MP Biomedical and histone H4 from New England Biolabs.
+ Open protocol
+ Expand
4

Interrogating DNA-Binding Motifs with Modified Cytosines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Twenty single-stranded DNA (ssDNA) cartridge-purified 28-mer oligonucleotides (both sense and anti-sense strands for C, 5mC, 5hmC, 5fC, and 5caC) were purchased from W. M. Keck Oligonucleotide Synthesis Facility, Yale to examine two DNA sequences: the C/EBP consensus motif (TTGC|GCAA) and chimeric C/EBP|CRE motif (TTGC|GTCA). These oliogs were validated by capillary electrophoresis and gave single peaks for each oligo. Five 28-mer DNAs for the C/EBP consensus motif (CTGACCCATATTGC|GCAATCTGACTGAC) termed sense-strand (a) contained different versions of cytosine in bold (C, 5mC, 5hmC, 5fC, and 5caC). The C/EBP consensus motif is underlined and the center of the dyad is marked. Five 28-mer DNAs termed anti-sense strand (b) (GTCAGTCAGATTGC|GCAATATGGGTCAG) contained different versions of cytosine in bold. The chimeric C/EBP|CRE 28-mer on the sense-strand (a) is CTGACCCATATTGC|GTCATCTGACTGAC. The anti-sense strand was end-labeled with γ−32P ATP (specific activity 5000 Ci/mmol, MP Biomedicals) using T4 polynucleotide kinase (New England Biolabs), and was purified by the ProbeQuant G-50 micro column (GE Healthcare Biosciences). The double-stranded DNA (dsDNA) probes were generated by annealing the labeled anti-sense strand and unlabeled sense strand.
+ Open protocol
+ Expand
5

Characterization of β2-Adrenergic Receptor

Check if the same lab product or an alternative is used in the 5 most similar protocols
African green monkey kidney cells (COS-7) were from the American Tissue Culture Collection (ATCC). N-terminal FLAG-tagged human β2AR cDNA in a mammalian cell expression vector (pcDNA3-FLAG-β2AR) was a gift from Dr. Jeffrey Benovic (Thomas Jefferson University, Philadelphia, PA) (26 (link)). pcDNA3.1-HA-β2AR(Y326A) was a gift from Drs. Marc Caron and Larry Barak (27 (link), 28 (link)) (Duke University, Durham, NC). pcDNA3.1-Gβ and pcDNA3.1-Gγ were purchased from the Missouri University Science and Technology cDNA Resource Center, and bovine GRK2 cDNA in a mammalian cell expression vector, pcDNA3-GRK2 wild type (WT) and K220R (29 (link)), were provided by Dr. Jeffrey Benovic. [γ-32P]ATP was from MP Biomedical or PerkinElmer Life Sciences, FuGENE-HD was from Roche Applied Science or Promega, isoproterenol was from Sigma, and peptide N-glycosidase F was from New England Biolabs. Polyclonal antibodies recognizing β2AR Ser(P)355/Ser(P)356, the β2AR carboxyl tail (to detect total receptor), and GRK2 were obtained from Santa Cruz Biotechnology, Inc. Protein structure figures were generated using the PyMOL Molecular Graphics System.
+ Open protocol
+ Expand
6

Iron(II) Helicates Synthesis and Oligonucleotide Labeling

Check if the same lab product or an alternative is used in the 5 most similar protocols
The iron(II) helicates [Fe2L3]Cl4 (L = C25H20N4; Fig. 1a) were synthesised as previously described24 25 26 (link). The synthetic oligoribonucleotides used in this work were purchased from VBC-Biotech (Vienna, Austria). The ADP-1 polypeptide (Fig. 1c) was purchased from Schafer-N (Copenhagen, Denmark) and was >95% pure. T4 polynucleotide kinase was purchased from New England Biolabs (Beverly, MA). [γ-32P]-ATP was from MP Biomedicals, LLC (Irvine, CA). Acrylamide and bis(Acrylamide) were from Merck KgaA (Darmstadt, Germany). RNase A was from Roche (Mannheim, Germany).
+ Open protocol
+ Expand
7

Phospho-STAT3 T622 Antibody Production

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rabbit polyclonal antibody recognizing phosphorylated STAT3 T622 was customized from Boer Biotechnology. To prepare antibody recognizing STAT3 pT622, rabbits were treated with peptide containing STAT3 pT622. Nonmodified peptide immobilized on an affinity column was used to remove the antibodies recognizing nonphosphorylated STAT3, and STAT3 pT622 peptide immobilized on an affinity column was used to associate with and isolate the antibodies. The eluted antibodies were then concentrated.
Antibodies recognizing TAZ (#83669), STAT3 (#9139), MST2 (#3952), MST1 (#14946), YAP1 (#12395), SAV1 (#13301), and STAT3‐pY705 (#9145) were obtained from Cell Signaling Technology. Antibody simultaneously recognizing LATS1 and LATS2 (BS‐4081R) was obtained from Bioss. Antibodies recognizing LATS1/2 pT1079/T1041 (ab111344), Ki67 (ab16667), YAP1 (ab205270), HA (ab9110), tubulin (ab7291), Flag (ab205606), GST (ab36415), YAP1 pS127 (ab76252), phospho‐Thr (ab9337), JAK2 (ab108596), and recombinant IL‐6 protein (ab9627) were purchased from Abcam. Anti‐Flag agarose beads were obtained from Sigma. XMU‐MP‐1 was obtained from MedChemExpress. [γ‐32P]‐ATP was obtained from MP Biomedicals.
+ Open protocol
+ Expand
8

Radioactive EMSA Probe Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
We made EMSA probes using PCR from gblocks (IDT) acquired during cloning as templates and the following primers: H3/H4 promoter F1: CACAGCACGAAAGTCACTAAAGAAC, H3/H4 promoter R1: GTTTGAAAACACAATAAACGATCAGAGC. We 5′ end labeled one pmol of probe with γ−32P-ATP (MP Biomedicals) using T4 polynucleotide kinase (New England BioLabs) in a 50 μl total reaction volume at 37°C for 1 hour. We used Sephadex G-50 fine gel (Amersham Biosciences) columns to separate free ATP from labeled probes. We adjusted the volume of the eluted sample to 100 μl using deionized water so that the final concentration of the probe was 10 fmol/μl.
+ Open protocol
+ Expand
9

Helicase Activity Assay with Radiolabeled DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
A 70-mer oligonucleotide (“T”) was designed such that 40 nucleotides anneal to a M13mp18ssDNA plasmid (New England Biolabs), leaving a 30-mer polyT extension at the 5′ end. The 5′ end was previously radioactively labeled with γ-32P ATP (MP Biomedicals or Perkin Elmer) and T4 polynucleotide kinase (New England Biolabs), subsequently purified through a llustra MicroSpin G-50 column (GE Healthcare) and mixed with the M13mp18 ssDNA plasmid. The reactions were heat-denatured for 1 minute and annealed through gradual cooling to room temperature. Free oligonucleotide was separated by purification through MicroSpin S-400 HR columns (GE Healthcare). The helicase assays were carried out in 25mM HEPES pH 7.6, 10% glycerol, 50mM sodium acetate, 10mM magnesium acetate, 0.2mM PMSF, 1mM DTT, with addition of 250 μg/ml insulin. Desired protein concentrations were mixed with 1-2fmol of a circular M13 based DNA substrate and unwinding initiated in the presence of 0.3mM ATP in a total reaction volume of 10 μL at 30°C. Reactions were stopped after 30 minutes by addition of 0.1% SDS and 20mM EDTA, and the reaction products were immediately electrophoretically separated on a TBE-acrylamide gel (8% TBE with 0.1%SDS).
+ Open protocol
+ Expand
10

Cytosine Modifications in DNA Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
Twenty single-stranded DNA 28-mer (ssDNA) cartridge-purified oligonucleotides were purchased from W.M. Keck Oligonucleotide Synthesis Facility at Yale to examine two DNA sequences. Five 28-mer DNAs (CTGACCGATACGCAG|GTGCCTGACTGAC) termed the sense strand (a) contained different versions of the cytosine in bold (C, 5mC, 5hmC, 5fC, 5caC). The strong E-Box motif is underlined and the center of the dyad is marked. Five 28-mer DNAs termed the anti-sense strand (b) (GTCAGTCAGGCAC|CTGCGTATCGGTCAG) contained different versions of the cytosine in bold. The weak E-box 28-mer on the sense-strand (a) is CTGACCCATACGCAA|ATGTCTGACTGAC. The anti-sense strand was end-labeled with γ-32P ATP (specific activity 5000 Ci/mmol, MP Biomedicals) using T4 polynucleotide kinase (NEB), and was purified by ProbeQuant G-50 micro column (GE Healthcare Biosciences). dsDNA probes were generated by annealing the labeled anti-sense strand and unlabeled sense strand.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!