The largest database of trusted experimental protocols

Supercript 3 reverse transcriptase

Manufactured by Thermo Fisher Scientific
Sourced in United States

Superscript III Reverse Transcriptase is a thermostable enzyme used for the conversion of RNA to cDNA. It catalyzes the synthesis of first-strand cDNA from an RNA template.

Automatically generated - may contain errors

2 protocols using supercript 3 reverse transcriptase

1

Quantitative PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from tissues and HUVEC using the RNeasy kit (Qiagen). Supercript III Reverse Transcriptase (Invitrogen) was used for first strand cDNA synthesis. Quantitative real-time PCR was carried out using PerfeCTa SYBR Green Fastmix (Quanta Biosciences) on a Bio-Rad CFX96 system. Oligonucleotides used for human and mouse are listed in Supplementary Tables 3, 4, respectively.
+ Open protocol
+ Expand
2

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using NucleospinRNA kit (Bioke, Leiden, The Netherland) according to the supplier's instructions. RT was performed on 1 μg RNA using Supercript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA). After denaturation at 95°C for 2 min, PCR was performed for 40 cycles (1 min at 95°C, 45 s at 63°C, 45 s at 72°C) using SYBR Green (Roche). Transcript levels were compared relative to b-Actin housekeeping genes using the following primers: ACTB-Fwd CAGAAGGATTCCTATGTGGGCGA; ACTB-Rev TTCTCCATGTCGTCC
CAGTTGGT; EGFR-Fwd GTGATCCAAGCTGTCCCAAT; EGFR-Rev ACTGGTTGTGGCAGC
AGTC; ERBB2-Fwd TGTGTGGACCTGGATGACAA; ERBB2-Rev GATGAGGATCCCAAAG
ACCA; ERBB3-Fwd TGGGGAACCTTGAGATTGTG; ERBB3-Rev GAGGTTGGGCAATGGTAGAG
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!