Dneasy 96 blood and tissue kit

DNA was isolated using the Qiagen DNeasy^® 96 Blood and Tissue Kit (Qiagen, Germany) according to manufacturer’s protocols. Individual specimens were incubated overnight at 56 °C in the lysis buffer before performing the next extraction steps. In the end, DNA was recovered in a total of 100 μL of AE buffer (two elution steps of 50 μL AE buffer each).
With very few exceptions, sequences were obtained from the non-destructive extraction of a single wasp specimen (corpse kept as voucher). When destructive extraction was used, vouchers were selected among specimens sampled from the same tree and the same fig after careful identification by JYR. Destructive extraction was performed for the Miseq library. Vouchers are deposited at CBGP, Montferrier-sur-Lez, France.

The RCAS system [56 (link)] was chosen for a better overexpression of miR-M11 in CEF cells. The miR-M11 precursor sequence was cloned into the Not I restriction sites of the vector RCAS-B-GFP-CMV to make the miRNA-expressing plasmid, namely RCAS-B-GFP-CMV-M11. In 6-well plates, the confluent CEF cells were transfected with plasmids RCAS-B-GFP-CMV or RCAS-B-GFP-CMV-M11 (200 ng each) 3 days before virus infection and then the miR-M11 overexpressed CEFs were infected with RB-1BΔmiR-M11 while the mock transfected CEFs were separately infected with RB-1B or RB-1BΔmiR-M11 viruses (1000 PFU each per well). At 24, 48, 72, 96, and 120 hpi, infected cells were collected for DNA and miRNA extraction using the DNeasy 96 Blood and Tissue Kit or the miRNeasy Mini Kit (Qiagen, Manchester, United Kingdom), respectively. The viral copies for producing the growth curves of the viruses and the relative expression levels of miR-M11-5p and miR-M12-3p were separately determined by the real-time qPCR or qRT-PCR analysis as described above. For each virus, the experiments were repeated independently in triplicate and statistical analysis was performed as described above.

Blood was collected from infected mice semi-weekly through the acute phase of disease and then at five time points post-vaccination in the chronic phase of disease (at 77, 98, 115, 140, and 180 days post-infection). Total DNA was isolated from blood using a DNEasy 96 blood and tissue kit (Qiagen, 69581). Parasitemia was assessed by quantitative real-time PCR as previously described [27 (link)]. Briefly, PCR was performed using 10ng purified DNA, TaqMan Fast Advanced Master Mix (Life Technologies, 4444557), and oligonucleotides specific for the satellite region of T. cruzi nuclear DNA (primers 5’ ASTCGGCTGATCGTTTTCGA 3’ and 5’ AATTCCTCCAAGCAGCGGATA 3’, probe 5’ 6-FAM CACACACTGGACACCAA MGB 3’, Life Technologies, 4304972, 4316032) [56 (link), 57 (link)]. Data were normalized to GAPDH (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’ GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’, Life Technologies, 4304972, 4316032) [58 (link)], and parasite equivalents were calculated from a standard curve [27 (link), 59 (link), 60 (link)].

Selection of locations for arthropods collection was guided by finding sites of hares confirmed to have tularaemia and by F. tularensis DNA detected in water samples. Mosquito larvae were collected from suitable aquatic habitats in April 2015 and in April, May and June 2016. In July and August 2015, and in April, May and June 2016, adult mosquitos, tabanids and ticks were collected using BG sentinel traps, manning traps and dragging cloth method, respectively (Table, Figure). DNA extraction from individual ticks was carried out using alkaline lysis and DNA extraction from individual or pooled tabanids and mosquitos using the DNeasy 96 Blood and Tissue Kit (Qiagen). F. tularensis detection was performed by qPCR [17 (link)].

Blood samples were collected from Brown Hanwoo (BH), Brindle Hanwoo (BNH) and Jeju Black (JB). All three breeds are found in their native track in three different regions of the country. Breeds and number of samples used for the study are described in detail in Table 1. BH is a mainland breed while BNH and JB are island breeds. Utmost care was taken to avoid any crossbreds during sampling. YB (Chinese cattle) samples were made available by Dr. Lee SH from Chungnam National University in Daejon, South Korea. Genotyping data for the Asian cattle breeds was downloaded from dryad.org [11 ]. European taurine, African taurine and Zebu data was used from the Bovine Hapmap project. All the genotype data was then merged to make one final dataset. In the final dataset there were 576 samples and 35,598 SNPs.
Genomic DNA for genotyping assays was extracted from the blood sample using DNeasy 96 Blood and Tissue Kit (Qiagen, Valencia, CA, USA). DNA quantification was performed using a NanoDrop 1000 (Thermo Fisher Scientific Inc., Wilmington, DE, USA). DNA samples were submitted for genotyping with total DNA of 900 ng, 260/280 ratio >1.8, and DNA concentration of 20 ng/ul. The genotyping for animals was done by the Animal Genome & Bioinformatics Division of the National Institute of Animal Science, RDA, Korea, using a BovineSNP50 BeadChip Ver.1. (Illumina, San Diego, CA, USA).

We extracted total genomic DNA from ticks using either the DNeasy or DNeasy 96 Blood and Tissue kit (Qiagen, Hilden, Germany) or the Gentra PureGene Tissue Kit (Qiagen). B. miyamotoi was detected using quantitative polymerase chain reaction (qPCR) as described by Platonov et al. [24 (link)]. Briefly, we used a TaqMan Probe with 5’-6FAM and 3’-TAMRA (Life Technologies, Grand Island, NY) and iQ Supermix (Bio-Rad, Hercules, CA). Thermal cycling was conducted in a C1000 Thermal Cycler with the CFX96 Real-Time System (Bio-Rad). Ultrapure water served as negative controls. The qPCR target sequence was amplified from SCID+ B. miyamotoi-positive mouse blood, provided by Sam Telford III (Tufts University, North Grafton, MA) and cloned into the pCR2.1-TOPO plasmid (Life Technologies). Plasmid extracted from confirmed clones was used as our positive control. Three replicates per tick were amplified. A DNA was considered positive for B. miyamotoi if at least one replicate was called positive as determined by the default settings for the qPCR machine software (CFX Manager Software 3.0; Bio-Rad).

Extracellular HBeAg and HBV DNA levels were measured as previously described (13 (link), 42 (link)). HBeAg levels were measured by an electrochemiluminescence assay (Meso Scale Discovery, Rockville, MD). Extracellular HBV DNA was purified from cell culture medium using a DNeasy 96 blood and tissue kit (Qiagen) and quantified by qPCR on a QuantStudio 7 Flex real-time PCR system (Thermo Fisher Scientific), using primers and a probe designed for the HBx region of the HBV genome: forward primer 5′-CCG TCT GTG CCT TCT CAT CTG-3′, reverse primer 5′-AGT CCA AGA GTY CTC TTA TGY AAG ACC TT-3′, and probe 5′-56FAM [5(6)-carboxyfluorescein]-CCG TGT GCA-ZEN-CTT CGC TTC ACC TCT GC-3IABkFQ (Iowa Black fluorescein quencher)-3′. HBV DNA levels were normalized to β-actin.