Bacterial strains were grown overnight in LPM or LB. Thereafter, 4 ml of each strain were pelleted and resuspended in 100 μl of water containing 3 mg/ml lysozyme. RNA from these lysates was isolated with 1 ml of TRIzol reagent (Invitrogen) by using the protocol supplied by the manufacturer. An additional step of phenolization or the kit Direct-zolTM RNA MiniPrep Plus (Zymo Research) was carried out to obtain pure samples. RNA (∼1 μg) was reverse transcribed into cDNA with the Quantitect Reverse Transcriptase (Qiagen) before carrying out PCR with appropriate primers.
Quantitect reverse transcriptase
Manufactured by Qiagen
Sourced in Germany, United States
The QuantiTect Reverse Transcriptase is a high-performance enzyme used for the conversion of RNA to cDNA. It offers efficient and reliable reverse transcription for subsequent PCR or real-time PCR analysis.
Automatically generated - may contain errors
Lab products found in correlation
Taqman probe, by Thermo Fisher Scientific (4 mentions)
Trizol isolation, by Thermo Fisher Scientific (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Steponeplus, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (2 mentions)
Quantstudio 6 flex real time pcr system, by Thermo Fisher Scientific (2 mentions)
Cfx connect real time pcr machine, by Bio-Rad (2 mentions)
Sybr green jumpstart taq, by Merck Group (2 mentions)
Rneasy plus kit, by Qiagen (2 mentions)
Quantstudio 6 flex rt pcr system, by Thermo Fisher Scientific (2 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Direct zoltm rna miniprep plus, by Zymo Research (1 mentions)
Icycler iq real time detection system, by Bio-Rad (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
Ionomycin calcium salt, by Merck Group (1 mentions)
Dynabeads protein g for immunoprecipitation, by Thermo Fisher Scientific (1 mentions)
Blotto non fat dry milk, by Santa Cruz Biotechnology (1 mentions)
19 protocols using quantitect reverse transcriptase
1
Bacterial RNA Extraction and Reverse Transcription
2
Quantitative Real-Time PCR of mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using RNeasy kits (QIAGEN) and reverse transcribed to cDNA using QuantiTect Reverse Transcriptase (QIAGEN). Quantitative real-time PCR was performed with 25 ng of cDNA on an iCycler IQ real time detection system (Bio-Rad Laboratories Ltd., UK). Gene expression was determined using TaqMan Gene Expression Assays (Applied Biosystems, UK) relative to the level of the house keeping gene GAPDH using real time RT-PCR.
3
Immunoprecipitation and Western Blotting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibodies used in this study are reported in Supplementary Table S3 . Reagents and chemicals include: Ionomycin calcium salt (Sigma # I3909), Protein G-Agarose (Sigma #11243233001), Streptavidin Sepharose High Performance bead (Sigma #17-5113-01), Calmodulin Sepharose 4B (Sigma #17-0529-01), Dynabeads™ Protein G for Immunoprecipitation (Thermo Fisher Scientific #10004D), jetPRIME®, DNA and siRNA transfection reagent, Polyplus-transfection® reagent (VWR #89129-922), TRIzol™ Reagent (Thermo Fisher Scientific #15596018), Quantitect reverse transcriptase (Qiagen #205313), Xpert Protease inhibitor cocktail (GenDEPOT #P3100-100), Xpert Phosphatase inhibitor cocktail (GenDEPOT #P3200-020), Penicillin-Streptomycin (GenDEPOT #CA005-100), 10× PBS Buffer (GenDEPOT #P2100-100), DMEM, High Glucose with L-Glutamine (GenDEPOT #CM002-050), Opti-MEM™ Reduced Serum Medium (Thermo Fisher Scientific #31985070), FBS Opti-Gold, Us Origin (GenDEPOT #F0900-050), iTaq Universal SYBR® Green Supermix (Bio-Rad #1725124), Immun-Blot PVDF Membrane (Bio-Rad #1620177), TGX™ FastCast™ Acrylamide Kit (Bio-Rad #161-0173, #161-0175), Precision Plus Protein™ Dual Color Standards (Bio-Rad #1610394), Blotto, non-fat dry milk (Santa-Cruz # sc-2325), SuperSignal™ West Dura Extended Duration Substrate (Thermo Fisher Scientific #34076), VECTASHIELD HardSet Antifade Mounting Medium with DAPI (Vectorlabs #H-1500).
4
Quantification of Cadmium-Induced Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BEAS-2B cells (2×106 cells/well) in 6-well culture plates were treated in the absence or presence of Cd (Sigma, St. Louis, MO, USA) for 24 hours. Total RNA was extracted using Trizol (Invitrogen, Carlsbad, CA, USA) and reverse-transcribed to first-stand complementary DNA (cDNA) using random primer (9-mer) and QuantiTect reverse transcriptase (Qiagen, Hilden, Germany), according to the manufacturer's protocols. Transcripts were quantitated using Power SYBR Green PCR (Applied Biosystems, Foster City, CA, USA) and the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). Quantitation was normalized with 18s rRNA (internal control). Quantitative real time polymerase chain reaction was performed using primer sequences listed in Table 1 . For quality control, RNA purity and integrity were evaluated by OD 260/280 ratio and analyzed by Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA).
5
Investigating Long Non-coding RNAs in Chicken NDV Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Animal experimentation was conducted with white leghorn chicken breed as a research material and was in accordance with Institute animal ethics committee guidelines (452/01/ab/CPCSEA). At 3 weeks of age, birds were challenged with lentogenic D58 strain of NDV (106 EID50) via intraocular route while the control group received PBS simultaneously. Harderian gland samples were collected aseptically at 2, 6 and 10 DPC. Total RNA was isolated and cDNA was synthesized using quantitect reverse transcriptase (Qiagen, Germany). Gene specific primers were designed targeting the two lncRNAs selected randomly and GAPDH (as housekeeping gene) (Table 8 ). SYBR green based qRT-PCR was performed to analyse the relative expression levels using 2−∆∆CT43 (link).
Details of the Oligonucleotides used in the validation study.
| Gene | Forward (5′–3′) | Reverse (5′–3′) | Amplicon size (bp) | Annealing temperature (°C) |
|---|---|---|---|---|
| LNC 1 | 5′ ttggacacaggagaacagcttgag3' | 5′ gggttgaagaggattgcgtttgg3' | 247 | 60 |
| LNC 2 | 5′ ttccgtcacgtatcttccttctcca 3' | 5′ cgggatgatctgttgtgtgtggtagg 3' | 217 | 58.3 |
| GAPDH (NM_204305) | 5′ agcacccgcatcaaagg 3' | 5′ catcatcccagcgtcca 3' | 263 | 60 |
6
Colon Tissue RNA Isolation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from colon tissue using mechanical homogenization and TRIzol isolation (Invitrogen) according to the manufacturer’s instructions. cDNA was generated using QuantiTect reverse transcriptase (QIAGEN). RT-PCR was performed on cDNA using TaqMan primers and probes in combination with TaqMan PCR Master Mix (ABI), and reactions were run on a RT-PCR system (StepOne Plus, Applied Biosystems). Gene expression is displayed as fold increase over uninfected control mice and normalized to Hprt.
7
Midbrain RNA Isolation and qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ventral midbrain regions (∼10 mg) were micro‐dissected. Total RNA was isolated using an RNeasy Plus kit (Qiagen, Manchester, UK), and converted to cDNA using Quantitect Reverse Transcriptase (Qiagen) and then diluted 1:10 for subsequent qPCR analysis using SYBR Green JumpStart Taq (Sigma Aldrich, Gillingham, UK) on a CFX Connect Real‐Time PCR machine (Bio‐Rad, Watford, UK). Details are available in supplementary material, Supplementary materials and methods.
8
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was obtained using Trizol (Invitrogen)/chloroform extraction as described previously [19 (link)], quantified photometrically with a NanoPhotometer (Implen) and stored at -80°C until further use. cDNA from 500 ng total RNA was generated using QuantiTect reverse transcriptase (Qiagen) and diluted 1:10 to 1:1000 to determine a concentration for each gene that yielded a CT value between 15 and 25. Gene expression was analyzed using TaqMan Gene Expression Assays (Applied Biosystems) and a QuantStudio 3 Real-Time PCR System (Thermo Fisher). Data were normalized to the housekeeping gene cdc-42 and analyzed using the Δ/Δ-CT method.
9
RNA Isolation and RT-PCR Analysis
10
RNA Extraction and qRT-PCR Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from tissue (n = 63 subjects, early BMI 18.5–45.0) using RNeasy Mini Kit (Qiagen) coupled with on-column DNA digestion following the manufacturer’s standard protocol. RNA concentrations were determined using NanoDrop 2000. First strand cDNA was generated from 0.5 μg total RNA per sample using QuantiTect Reverse Transcriptase (Qiagen) with a mixture of random and oligo(dT) primers following the supplied protocol. cDNA samples were diluted 1:10 with DNase/RNase-free water, aliquoted to prevent freeze thawing and stored at -80°C prior to use. Real-time PCR was performed on StepOne Plus (Life Technologies) using SYBR Green PCR Master Mix (Life Technologies) according to the manufacturer's recommended protocol. Quantification was performed and target gene expression normalized to 18S rRNA, the expression of which did not differ between the groups. A list of all predesigned PCR primers (Integrated DNA Technologies) used in the qRT-PCR assay is provided in S5 Table .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!