Pi7_PLVPBnewSeq | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACTCGGTGCCACTTTTTCAA |
Pi5_PLVPBnobarcode | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCTTGTGGAAAGGACGAAACA |
Kapa hifi hot start ready mix
KAPA HiFi Hot start ready mix is a pre-formulated PCR mix designed for high-fidelity DNA amplification. It contains all the necessary components, including a high-fidelity DNA polymerase, dNTPs, and buffers, to perform reliable and efficient PCR reactions.
Lab products found in correlation
2 protocols using kapa hifi hot start ready mix
Pooled NGS Screening and Cell Sorting
Sequencing of ChIP and mRNA from Plasmodium falciparum
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!