Kapa hifi hot start ready mix

Pooled next-generation sequencing (NGS) screening was conducted as described in the results and depicted in Fig. 2a. Once FAC sorted via their MedFI, the DNA was extracted from each population. Cells were lysed for 4 h at 55 °C in DNA lysis buffer (50 mM Tris pH 8, 100 mM NaCl, 10 mM EDTA, 1% SDS and 0.5 mg/ml proteinase K (Thermo, EO0491)). After 4 h, DNA was precipitated using an equal volume of isopropanol and resuspended in TE. The gDNA was quantified using quBit, and the whole sample was used in multiple PCRs to enrich gRNA cassettes (2 µg DNA, 1.5 µL 10 µM primers, 25 µL Q5 master mix (NEB, M0492S)).

Pi7_PLVPBnewSeq	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACTCGGTGCCACTTTTTCAA
Pi5_PLVPBnobarcode	TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCTTGTGGAAAGGACGAAACA

The PCRs were pooled, bead purified, and the product was used in a second PCR to add index adaptors (25 µL KAPA HiFi Hot start ready mix, 1 µL 10 µM primers i5 and i7 combinations). The product was quantified using the NEBNext Library Quant Kit for Illumina (NEB, E7630S) diluted to 4 nM and sequenced by NextSeq (Illumina) using the manufacturer’s instructions for NextSeq 500/550 High Output Kit 75 Cycles (Illumina, 20024906).

Libraries from sonication ChIP samples were prepared using the Encore Multiplexing System (NuGEN, San Carlos, CA) according to the manufacturer’s instructions, with the following modifications for the high AT-content of the P. falciparum genome: libraries were amplified for a total of 15 PCR cycles (5 cycles of [15s at 98°C, 30s at 55°C, 30s at 62°C] followed by 10 cycles of [15 s at 98°C, 30s at 63°C, 30s at 72°C]) using KAPA HiFi HotStart Ready Mix (Kapa Biosystems, Woburn, MA). Libraries from MNase ChIP samples were prepared using the NEBNext ChIP-Seq Library Preparation kit (NEB) according to the manufacturer’s instructions, with the following modifications for the high AT-content of the P. falciparum genome: libraries were amplified for a total of 11 PCR cycles (3 cycles of [15 s at 98°C, 30s at 55°C, 30s at 62°C] followed by 8 cycles of [15 s at 98°C, 30s at 63°C, 30s at 72°C]) using KAPA HiFi HotStart Ready Mix. Libraries were sequenced with a HiSeq 2000 (Illumina, San Diego, CA), generating 50 bp paired-end sequence reads. Sequence reads are available through the Short Read Archive under BioProject numbers SRP026365 (nucleosome positioning data) and SRP026367 (steady-state mRNA data gametocytes). Steady-state mRNA sequence data from ring, trophozoite and schizont stages are available under accession numbers SRS417027, SRS417268, and SRS417269, respectively.