Milrinone

Manufactured by Merck Group

Sourced in United States

Milrinone is a type of lab equipment manufactured by Merck Group. It is a phosphodiesterase III inhibitor used to improve cardiac contractility and increase cardiac output. The core function of Milrinone is to enhance myocardial function in patients with congestive heart failure.

Automatically generated - may contain errors

Lab products found in correlation

53 protocols using milrinone

Knockdown of CBS expression in GV oocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The COCs were cultured at 37°C with 5% CO₂ for 1 h in the MEM alpha (1×) medium containing 3.33 μM milrinone (Sigma) and 10% FBS to be arrested at GV stage. The GV‐intact oocytes were microinjected with 10 pl of 1 mM Cbs morpholino oligo (5′‐ATTTTCAGAGGGAGCGAAGACCT‐3′, Gene Tools) to knockdown CBS expression or 10 pl of 1 mM standard control oligo (5′‐CCTCTTACCTCAGTTACAATTTATA‐3′, Gene Tools) as a Control group. GV oocytes without microinjection were designated as the Uninjected group. Oocytes were cultured for 24 h in M16 medium (Sigma) containing 3.33 μM milrinone and washed in milrinone‐free MEM (1×) + GlutaMAX‐I. Then they were transferred to M16 medium without milrinone and incubated for 0, 8, and 17 h for immunofluorescence and western blot.

Cao Y., Zhu X., Zhen P., Tian Y., Ji D., Xue K., Yan W., Chai J., Liu H, & Wang W. (2022). Cystathionine β‐synthase is required for oocyte quality by ensuring proper meiotic spindle assembly. Cell Proliferation, 55(12), e13322.

+ Open protocol

+ Expand

Cytoplasmic Injection of siRNA in GV Oocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Germinal Vesicle stage (GV) oocytes were collected from 5 to 8 weeks old B6CBAF1 (Janvier Labs, France) female mice at 39 h post-PMSG (Pregnant mare’s serum gonadotrophin, Intervet, France) injection. GV oocytes pick-up was performed in M2 medium (Sigma) supplemented with 2.5 μM Milrinone (Sigma) to maintain prophase I arrest. Cumulus cells were removed by repeated pipetting. Ten pl of siRNA solution were injected into the cytoplasm of denuded GV oocytes 1 hour after their retrieval, using a 1.2 µm inner diameter pipette (BioMedical Instruments, Germany) connected to a FemtoJet injector (Eppendorf, Germany) under a Nikon inverted microscope in the same M2 medium containing Milrinone at room temperature. Oocytes were then washed several times to remove Milrinone and matured in vitro in M16 medium (Sigma) during 24 or 48 h at 37°C, 5% CO₂ in air. siRNA against Ezrin (sc-35350), Radixin (sc-36367), Moesin (sc-35956), ERM (sc-37850) EWI-2 (sc-105564) and EWI-F (sc-142204) siRNA from Santa Cruz biotechnology were used at 1 μM final concentration. Control oocytes were injected following the same protocol with the same volume and concentration of control (CTRL) siRNA-A solution (sc-37007, Santa Cruz biotechnology). Figure 1 represents the experimental design of the study.

Cohen J., Wang L., Marques S., Ialy-Radio C., Barbaux S., Lefèvre B., Gourier C, & Ziyyat A. (2022). Oocyte ERM and EWI Proteins Are Involved in Mouse Fertilization. Frontiers in Cell and Developmental Biology, 10, 863729.

+ Open protocol

+ Expand

Murine Oocyte Maturation and Chiasma Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Germinal-vesicle stage oocytes were collected from mature mice (2-4 months old) without prior hormonal stimulation. Only oocytes with integral cumulus cell layers were used. 20-30 oocytes were collected per mouse. Surrounding cumulus cells were mechanically removed for observation of Germinal Vesicle Breakdown (GVBD) and Polar Body Extrusion (PBE). Oocytes were manipulated in M2 medium containing 2.5 μM milrinone (Sigma-Aldrich) under mineral oil at 37°C and maturation was stimulated by milrinone washout (Yun et al., 2014 (link)). GVBD was scored every 20 minutes by manual inspection over the first 2 hours and then scored again after 3 hours. Only oocytes that underwent GVBD within 3 hours were used to quantify PBE after 15 hours of incubation. All incubation times were relative to milrinone washout. To count chiasmata, oocytes were cultured in M2 media for 7 h, and then prepared for metaphase-I chromosome spreads (Chambon et al., 2013 (link)). Acid Tyrode’s solution (Sigma-Aldrich) was applied to remove zona pellucida, and zona-free oocytes were spread in 1% paraformaldehyde plus 0.15% Triton-X-100. DNA was stained with DAPI and centromeres were immunostained with human anti-centromere antibodies (ACA; HCT-0100 ImmunoVision, 1:1000 dilution) overnight at room temperature, followed by anti-human 555 (Molecular Probes, 1: 1000 dilution) secondary antibody for 1 h at 37°C.

Qiao H., Prasada Rao H.B., Yun Y., Sandhu S., Fong J.H., Sapre M., Nguyen M., Tham A., Van B.W., Chng T.Y., Lee A, & Hunter N. (2018). Impeding DNA Break Repair Enables Oocyte Quality Control. Molecular cell, 72(2), 211-221.e3.

+ Open protocol

+ Expand

Cisplatin Exposure in Mouse Oocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

This study was reviewed and approved by the Ethics Committee of Peking University Third Hospital (No. LA2018256), and all mice were kept and treated following the policies promulgated by the Ethics Committee on the use of animals in research. Female ICR mice at 6–8 weeks of age were sacrificed by cervical dislocation 44–46 h after intraperitoneal injection of 10 IU pregnant mare serum gonadotropin (PMSG, NSH, Ningbo, China). Immature oocytes displaying clear germinal vesicles (GVs) were collected and cultured in M2 medium (Sigma-Aldrich, MO, USA) supplemented with 2.5 μM milrinone (Sigma-Aldrich) to maintain the prophase of meiosis I arrest. For cisplatin treatment, immature oocytes were cultured in M16 medium (containing 2.5 μM milrinone) with low (1 μM) or high (20 μM) dosages of cisplatin (Sigma-Aldrich) for 4 h, then oocytes were washed and cultured in fresh M16 (Sigma-Aldrich) medium until they reached the MII stage. The matured oocytes were fertilized by intracytoplasmic sperm injection and cultured in KSOM (Sigma-Aldrich) at 37 °C in a 5% CO₂ atmosphere.

Zhang N., Sun A.D., Sun S.M., Yang R., Shi Y.Y., Wang Q.L., Li X.Y., Ma J.H., Yue W., Xie B.T., Qiao J, & Li M. (2021). Mitochondrial proteome of mouse oocytes and cisplatin-induced shifts in protein profile. Acta Pharmacologica Sinica, 42(12), 2144-2154.

+ Open protocol

+ Expand

GV Oocyte Maturation Dynamics

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immature oocytes were collected from the ovaries of 8-week-old female ICR mice into M2 medium (Sigma, St. Louis, MO, USA) with 2.5 μM milrinone (Sigma), which was used to maintain oocytes at the GV (germinal vesicle) stage. Only fully grown oocytes with a GV were further cultured in M2 medium in a humidified incubator of 5% CO₂ at 37°C. The rate of GVBD (germinal vesicle break down) was measured after 2 h in culture, according to disappearance of the GV.

LIN F., CAO S.B., MA X.S, & SUN H.X. (2017). Inhibition of casein kinase 2 blocks G2/M transition in early embryo mitosis but not in oocyte meiosis in mouse. The Journal of Reproduction and Development, 63(3), 319-324.

+ Open protocol

+ Expand

Meiotic Resumption and Maturation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

To prevent spontaneous meiotic resumption 2.5 μM milrinone (Sigma-Aldrich) was added to bicarbonate free minimal essential medium (MEM) containing, 25 mM Hepes, pH 7.3, 3 mg/mL poyvinylpyrrolidone (PVP) for oocyte collection and microinjection. To induce meiotic resumption, oocytes were cultured in milrinone- free Chatot, Ziomek, and Bavister (CZB) medium in an atmosphere of 5% CO₂ in air at 37°C[47 (link)]. Oocytes that had not undergone nuclear envelope breakdown within 2 hours of meiotic resumption were removed from the experiment. Oocytes were matured for 7.5 h for metaphase I experiments or 18 h for metaphase II analysis.

Nguyen A.L., Drutovic D., Vazquez B.N., Yakoubi W.E., Gentilello A.S., Malumbres M., Solc P, & Schindler K. (2018). Genetic interactions between the Aurora kinases reveal new requirements for AURKB and AURKC during oocyte meiosis. Current biology : CB, 28(21), 3458-3468.e5.

+ Open protocol

+ Expand

Isolation and Culture of Mouse Ovarian Follicles

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ovaries were harvested from reproductively young and old mice in Leibovitz's L‐15 medium (Life Technologies Corporation, Grand Island, NY, USA) supplemented with 3 mg/mL polyvinylpyrrolidone (Sigma‐Aldrich, St. Louis, MO, USA) and 0.5% Pen Strep (Life Technologies; L15/PVP). Ovaries were disrupted mechanically using insulin syringes and late primary to transitioning secondary‐stage follicles were identified based on size and morphology and collected. For short‐term culture (maximum of 40 min), follicles were cultured in CZB media (EMD Millipore, Billerica, MA, USA) overlaid with mineral oil in a humidified atmosphere of 5% CO₂ in air at 37 °C. Follicles were imaged using the EVOS FL Auto Cell Imaging system, and the mean diameter was determined based on two perpendicular measurements from basement membrane to basement membrane. These follicles were used for downstream experiments as described below. For RPS2 immunoblot analysis, cumulus–oocyte complexes (COCs) from small antral follicles were released following mechanical disruption of the tissue using insulin syringes. COCs were collected in L15/PVP supplemented with 2.5 μm milrinone (Sigma‐Aldrich) to maintain meiotic arrest. Oocytes within the COCs were mechanically stripped free of cumulus cells, and denuded oocytes were immediately snap‐frozen.

Duncan F.E., Jasti S., Paulson A., Kelsh J.M., Fegley B, & Gerton J.L. (2017). Age‐associated dysregulation of protein metabolism in the mammalian oocyte. Aging Cell, 16(6), 1381-1393.

+ Open protocol

+ Expand

Oocyte Maturation Dynamics via mRNA Microinjection

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Recombinant mRNA for microinjection was prepared by in vitro transcription of 500 ng of linearized mCHERRY or ELAVL2°-mCHERRY plasmids using the mMESSAGE kit (Ambion) according to the manufacturer’s instructions. Recombinant mRNA was polyadenylated using ATP-polyA tailing kit (Ambion) and purified by RNeasy mini kit columns (Qiagen). Fully grown GV oocytes for microinjection were obtained from PMSG-primed H2B-GFP mice⁶³ (link) backcrossed to CD1 strain. Oocytes were microinjected with approximately 5 pl of in vitro transcribed mRNA (336 or 112 µg/ml) and cultured for 2 h in OptiMEM medium supplemented with 10% FCS (Invitrogen) containing 2.5 µM milrinone (Sigma) that reversibly blocks maturation of oocytes. After 2 h, oocytes were washed in milrinone-free medium and let to mature for 18.5 h. Leica TSC SP5 (Leica Microsystems) equipped with an HCX PL Apo Lambda Blue 40× 1.25 oil objective was used for time-lapse confocal microscopy. Images(12 z-confocal sections every 7.4 µm, 1024 × 1024 xy pixel resolution, 16 bit depth) were acquired every 10 min for 18 h. Imaging started 40 min after milrinone removal.

Chalupnikova K., Solc P., Sulimenko V., Sedlacek R, & Svoboda P. (2014). An oocyte-specific ELAVL2 isoform is a translational repressor ablated from meiotically competent antral oocytes. Cell Cycle, 13(7), 1187-1200.

+ Open protocol

+ Expand

Microinjection of RNA into Oocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA for injection was diluted in pure water such that a given number of molecules would be present in five picoliters (pl). For a typical microinjection, an injection mixture consisted of in vitro transcribed firefly and nanoluciferase (NanoLuc) RNA in the ratio of 100,000:10,000 or in a ratio of 100,000:100,000 molecules with or without let-7a or miR-30c mimic (Sigma, HMI0001-5NMOL and HMI0458-5NMOL, respectively). Microinjections were done with a FemtoJet microinjector (Eppendorf). Femtojet injection pressure was set to maintain injection volume of 5 pl for all microinjections. Reliability of the estimated amount of microinjected molecules was examined experimentally (Supplementary Figure S2A).
Injected mouse oocytes were cultured in M16 media (Merck) supplemented with IBMX in 5% CO₂ at 37°C for 20 h. Bovine oocytes were cultured in MPM media (prepared in house (39 (link))) containing 0.1 mM milrinone (Sigma) without a paraffin overlay in a humidified atmosphere at 39°C with 5% CO₂ for 20 h. Pig oocytes were cultured in M-199 MEDIUM (Gibco) supplemented with 1 mM dbcAMP, 0.91 mM sodium pyruvate, 0.57 mM cysteine, 5.5 mM Hepes, antibiotics and 5% foetal calf serum (Sigma). Injected oocytes were incubated at 38.5°C in a humidified atmosphere of 5% CO₂ for 20 h.

Kataruka S., Modrak M., Kinterova V., Malik R., Zeitler D.M., Horvat F., Kanka J., Meister G, & Svoboda P. (2020). MicroRNA dilution during oocyte growth disables the microRNA pathway in mammalian oocytes. Nucleic Acids Research, 48(14), 8050-8062.

+ Open protocol

+ Expand

Oocyte-Granulosa Cell Coculture Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The basic culture medium was bicarbonate buffered MEMα (Minimum Essential Medium α; Thermo Fisher Scientific, Gaithersburg, MD, USA) supplemented with 75 μg/ml of penicillin G, 50 μg/ml of streptomycin sulfate, and 3 mg/ml of bovine serum albumin (BSA; Sigma-Aldrich, St. Louis, MO, USA). When investigating the effect of oocytes on MGCs, the basic culture medium supplemented with 10 nM of the phosphodiesterase inhibitor, milrinone (Sigma-Aldrich), was used to prevent spontaneous maturation of oocytes. In some experiments, the basic culture medium was supplemented with 10^–7 M of 17β-estradiol (Sigma-Aldrich), recombinant human BMP15 (50 ng/ml; R&D Systems, Minneapolis, MN, USA), recombinant mouse GDF9 (50 ng/ml; R&D Systems), and/or an inhibitor of ALK5, SB431542 (10 μM; FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan).

Ito H., Emori C., Kobayashi M., Maruyama N., Fujii W., Naito K, & Sugiura K. (2022). Cooperative effects of oocytes and estrogen on the forkhead box L2 expression in mural granulosa cells in mice. Scientific Reports, 12, 20158.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!