Anti p c jun

Manufactured by Cell Signaling Technology

Sourced in United States

Anti-p-c-Jun is an antibody product offered by Cell Signaling Technology. It is designed to detect the phosphorylated form of the c-Jun protein, a transcription factor involved in cellular signaling pathways.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

C-Jun (263 citations) P-c-Jun (111 citations) Anti-c-Jun (99 citations) P-JUN (10 citations) Rabbit anti-p-c-Jun (9 citations) Anti-p-c-Jun N-terminal kinase (JNK), (3 citations) Anti-p-c-Jun ser63 (3 citations) Anti-p-c-Jun antibody (2 citations) Anti‐p‐c‐JUN(ser73), (2 citations) Anti–phosphorylated c‐Jun NH2‐terminal kinase (P‐JNK; (2 citations)

22 protocols using anti p c jun

Immunoblotting Analysis of Cell Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole-cell lysates were prepared in RIPA lysis buffer and analyzed by immunoblotting with anti-MUC1-C (Thermo Scientific, Waltham, MA, USA,) anti-DICER, anti-Argo-2, anti-p-c-Jun, anti-c-Jun (Cell Signaling, Danvers, MA, USA) anti-PD-L1 (Abcam, Cambridge, MA, USA), anti-JNK, antiphospho- JNK, anti-ERK, anti-phospho-ERK, anti-GAPDH and anti-β-actin (Cell Signaling, Danvers, MA, USA) as described.³¹ Immune complexes were detected using horseradish peroxidase-conjugated secondary antibodies and enhanced chemiluminescence (GE Healthcare, Little Chalfont, UK).

Pyzer A., Stroopinsky D., Rosenblatt J., Anastasiadou E., Rajabi H., Washington A., Tagde A., Chu J.H., Coll M., Jiao A., Tsai L., Tenen D., Cole L., Palmer K., Ephraim A., Leaf R., Nahas M., Apel A., Bar-Natan M., Jain S., McMasters M., Mendez L., Arnason J., Raby B., Slack F., Kufe D, & Avigan D. (2017). MUC1 inhibition leads to decrease in PD-L1 levels via upregulation of miRNAs. Leukemia, 31(12), 2780-2790.

+ Open protocol

+ Expand

Immunoblotting Analysis of Tight Junction Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total protein was extracted from CRC tissues and cultured cells and subjected to immunoblotting, as previously described [20 (link)]. Primary antibodies including rabbit polyclonal anti-claudin-1 (1:1000), anti-claudin-2 (1:500), anti-claudin-3 (1:1000), and anti-claudin-7 (1:1000) were obtained from Abcam (Cambridge, MA, USA). Primary antibody rabbit polyclonal anti-occludin (1:400) was purchased from Invitrogen (Carlsbad, CA, USA). Primary antibodies including rabbit polyclonal anti-E-cadherin (1:1000), anti-c-kit (1:1000), anti-c-Jun (1:1000), anti-p-c-Jun (1:1000), anti-JNK (1:1000), and anti-p-JNK (1:1000) were obtained from Cell Signaling Technology (Beverly, MA, USA). Mouse monoclonal anti-β-actin (1:2000) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The proteins were detected using enhanced chemiluminescence (ECL) (ThermoFisher Scientific, Waltham, MA, USA) and viewed in Fusion FX Vilber Lourmat (Paris, France).

Wang Y., Sun T., Sun H., Yang S., Li D, & Zhou D. (2017). SCF/C-Kit/JNK/AP-1 Signaling Pathway Promotes Claudin-3 Expression in Colonic Epithelium and Colorectal Carcinoma. International Journal of Molecular Sciences, 18(4), 765.

+ Open protocol

+ Expand

Proteasome Subunit Immunoblotting Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Equal amounts of protein extracts were separated by SDS-PAGE and transferred onto nitrocellulose membranes (Merk, Darmstadt, Germany). I-proteasome subunits were analyzed by immuno-blotting using anti-mouse anti-β5i/LMP7, anti-β5, anti-β1i/LMP2 (Abcam, Cambridge, UK) and anti-β1, anti-β2i/MECL-1, anti-α4 (self-made), and AP1 components, anti-(p)-cJun, anti-(p)-cFos, anti-cFos, anti-(p)-ATF-2, anti-ATF-2 (Cell signaling, Leiden, Netherlands), and anti-cJun (Santa Cruz Biotechnologie, Dallas, Texas, USA) antibodies combined with a secondary polyclonal mouse-anti-rabbit-IgG antibody conjugated to horseradish peroxidase (Dianova, Hamburg, Germany). Anti-β-actin antibody (Cell signaling, Leiden, Netherlands) was used as loading control.

Kirschner F., Reppe K., Andresen N., Witzenrath M., Ebstein F, & Kloetzel P.M. (2016). Proteasome β5i Subunit Deficiency Affects Opsonin Synthesis and Aggravates Pneumococcal Pneumonia. PLoS ONE, 11(4), e0153847.

+ Open protocol

+ Expand

Western Blot Analysis of Cell Signaling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Western blotting was performed as described previously [20 (link),21 (link)]. The following antibodies were used in this study: anti-SMAD4 (sc-7154 or sc-7966), anti-E-cadherin (sc-8426), anti-vimentin (sc-7557), anti-CD133 (sc-8304), anti-CD44 (sc-18849), anti-Sp1(sc-14027), anti-c-Jun (sc-1694), anti-Fos (sc-52), anti-Fast-1 (sc-377358), anti-Hes1 (sc-25392), anti-GAPDH (sc-32233; Santa Cruz Biotechnology, Inc.), anti-p-Akt (#4060), anti-Akt (#4691), anti-p-p44/42 (#9101),anti-p44/42 (#4695), anti-Pten (#9272), anti-NF-κB (#4764S), anti- EGFR (#4267), anti-p-EGFR tyr 992 (#2235), anti-p-EGFR tyr 1068 (#3777), anti-Smad2/3 (#5339), anti-p-Smad2/3 (#3101), anti-p-c-Jun (#2361; Cell Signaling Technology, Inc.), anti-Nestin (N5413), mouse anti-β-actin (Sigma- Aldrich Co.), anti-CD133/1 (AC133, Miltenyi Biotec.) and anti-TGF-β1 (ab9758, Abcam, Plc.).

Chen Y.W., Hsiao P.J., Weng C.C., Kuo K.K., Kuo T.L., Wu D.C., Hung W.C, & Cheng K.H. (2014). SMAD4 Loss triggers the phenotypic changes of pancreatic ductal adenocarcinoma cells. BMC Cancer, 14, 181.

+ Open protocol

+ Expand

Western Blot Analysis of Autophagy and Stress Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were harvested and lysed with 20 mM Tris, 135 mM NaCl, 10% glycerol, 1% NP40, pH 6.8. Protein content of cell lysates was measured using Pierce BCA Protein Assay (Thermo Scientific, Waltham, MA, USA, 23225). During each procedure equal amounts of protein were used. SDS-PAGE was done by using Hoefer miniVE (Amersham, UK). Proteins were transferred onto Millipore (Billerica, MA, USA) 0.45 µm PVDF membrane. Immunoblotting was performed using TBS Tween (0.1%), containing 5% non-fat dry milk for blocking membrane and for antibody solutions. Loading was controlled by developing membranes for GAPDH or dyed with Ponceau S in each experiment. The following antibodies were applied: antiLC3B (SantaCruz, Santa Cruz, CA, USA, sc-16755), antiPARP (Cell Signaling, Danvers, MA, USA 9542S), antiGADD 153 (SantaCruz, sc-7351), antiCREB-2 (SantaCruz, sc-200), antiP-c-Jun (Cell Signaling, 9261S), antic-Jun (Cell Signaling, 9165S), antiPERK (Cell Signaling, 3192S), antiULK1 (Cell Signaling, 8054S), antiP-ULK1 (S555) (Cell Signaling, 5869S), antieIF2α (Cell Signaling, 9722S9), antiP-eIF2α (Cell Signaling, 9721L), and antiGAPDH (Santa Cruz, 6C5), HRP conjugated secondary antibodies (SantaCruz, sc-2020 and Cell Signaling, 7074S, 7076S).

Márton M., Kurucz A., Lizák B., Margittai É., Bánhegyi G, & Kapuy O. (2017). A Systems Biological View of Life-and-Death Decision with Respect to Endoplasmic Reticulum Stress—The Role of PERK Pathway. International Journal of Molecular Sciences, 18(1), 58.

+ Open protocol

+ Expand

Signaling Pathway Antibody Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

All chemicals or reagents used in the present study were purchased from Sigma (St Louis, MO, USA) unless otherwise indicated. Anti-culsterin was purchased from Boster Biological Technology (Wuhan, China), and anti-GAPDH antibody was purchased from Cell Signaling (Boston, MA, US). All other antibodies including anti-JNK, anti-p-JNK, anti-c-Jun, anti-p-c-Jun, anti-ERK, anti-p-ERK, and anti-β-actin were from Cell Signaling Technology (Danvers, MA, USA).

Tian Y., Xiao Y., Wang B., Sun C., Tang K, & Sun F. (2018). Vitamin E and lycopene reduce coal burning fluorosis-induced spermatogenic cell apoptosis via oxidative stress-mediated JNK and ERK signaling pathways. Bioscience Reports, 38(4), BSR20171003.

+ Open protocol

+ Expand

Hepatic FGF19 signaling analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Frozen liver tissues were lysed in a RIPA buffer supplemented with protease inhibitor cocktail (Complete Mini Tablets, Roche) and phosphatase inhibitors (PhosSTOP EASYpack, Roche). Sixty micrograms of protein were resolved in SDS polyacrylamide gels and transferred onto a PVDF membrane using semi-dry transfer (Immobilon-P, Millipore). Primary antibodies were as follows: anti-FGF19 (MAB969, R&D Systems), anti-FGFR4 (8562; Cell Signalling), anti-CYP7A1 (sc-25536, Santa Cruz), anti-SHP (sc-15283, Santa Cruz), anti-ERK1/2 (4695S; Cell Signalling), anti-P-ERK1/2 (9101S; Cell Signalling), anti-cJun (9165, Cell Signaling), anti- P-cJun (2361, Cell Signaling). Protein loading was normalized to α/β tubulin (2148; Cell Signalling) or to β-actin (sc-47778; Santa Cruz). The bands were visualized with SuperSignal West Pico Chemiluminescent detection system, (Thermo Scientific). Image and densitometry analyses were performed with MicroChemi Imaging Systems and GelQuant software (DNR Bio-Imaging, Israel).

Wunsch E., Milkiewicz M., Wasik U., Trottier J., Kempińska-Podhorodecka A., Elias E., Barbier O, & Milkiewicz P. (2015). Expression of hepatic Fibroblast Growth Factor 19 is enhanced in Primary Biliary Cirrhosis and correlates with severity of the disease. Scientific Reports, 5, 13462.

+ Open protocol

+ Expand

Quantification of Apoptotic Signaling Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein was extracted from tissue samples with RIPA lysis buffer (Beyotime, Shanghai, China) containing 1 mM PMSF and a cocktail of protease and phosphatase inhibitors using standard methods. Solubilized proteins (30 µg) were separated by standard SDS-PAGE on a 10% polyacrylamide separating gel and 5% stacking gel and then transferred to a PVDF western blot membrane (Roche) using standard methods. The following primary antibodies were used: anti-RIP3 (dilution of 1:500; Abgent), anti-JNK, anti-c-Jun, anti-p-JNK, anti-p-c-Jun, anti-AKT, anti-p-AKT, anti-ERK, anti-p-ERK, anti-p38, anti-p-p38, p-MLKL and cleaved caspase-3 (dilution of 1:1000; Cell Signaling Technology). After washing, the membranes were incubated with horseradish-peroxidase conjugated secondary antibodies (Pierce). Protein bands were visualized using an enhanced chemiluminescence (ECL) Plus Western blotting detection kit (Amersham Biosciences) according to the manufacturer's instructions. A PageRuler Prestained Protein Ladder Plus (Fermentas Life Sciences) was used for sizing the proteins.

Liu Z.Y., Zheng M., Li Y.M., Fan X.Y., Wang J.C., Li Z.C., Yang H.J., Yu J.M., Cui J., Jiang J.L., Tang J, & Chen Z.N. (2019). RIP3 promotes colitis-associated colorectal cancer by controlling tumor cell proliferation and CXCL1-induced immune suppression. Theranostics, 9(12), 3659-3673.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation of Transcription Factors

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP was carried out using the EZChip kit (Millipore) according to the manufacturer’s protocol. Five million LEC were seeded into 15 cm plates and grown to 90% confluency in EGM-2MV media. Then they were treated with 10 ng mL⁻¹ IL6 or vehicle overnight. The cells were crosslinked with 1% formaldehyde for 10 min and sonicated with a Covaris S220 (20% duty cycle, 5 intensity, 200 burst per cycle, 30 cycles of 30 sec) for 30 min on ice. The immunoprecipitations were performed using anti-pATF-2, anti-pc-Jun, and anti-pStat3 antibodies (all from Cell Signaling) or control IgG and the ChIP DNA in the complex was amplified using the primers for the CCL5 promoter regions. Three regions of the CCL5 promoter with the CRE site (−316 to −69 bp, site 2) and two distal sites (−1064 to −815 bp, site 1; and −474 to −711 bp, site 3) were tested. The primer sequences for Site 1, Site 2, and Site3 are GGGTTCTGATCCCAACTCTG (forward)/ AGCGCGTGTCAACTCATTTA (reverse); ACTGCCACTCCTTGTTGTCC (forward)/ GCATTGGCCGGTATCATAAG (reverse); TCTGACTCATGCCTGTCAGC (forward)/ GTGCCAAAATCAGCACAATG (reverse), respectively. PCR products were analyzed by agarose gel electrophoresis and by real time quantitative PCR.

Lee E., Fertig E.J., Jin K., Sukumar S., Pandey N.B, & Popel A.S. (2014). Breast cancer cells condition lymphatic endothelial cells within pre-metastatic niches to promote metastasis. Nature communications, 5, 4715.

+ Open protocol

+ Expand

Molecular Signaling Pathway Immunodetection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Anti-pSMAD2/3, anti-SMAD2/3, anti-pJNK1/2, anti-JNK1/2, anti-p-c-Jun, anti-c-Jun and anti-pCAMKII primary antibodies were purchased from Cell Signalling Technology, USA. Anti-p-ATF2 and anti-ATF2 antibodies were purchased from Santa Cruz Biotechnology, USA. Anti-CAMKII antibody was purchased from Abcam and beta-actin antibody was from Sigma-Aldrich. Anti- rabbit/mouse imunnoglobulin conjugated horseradish peroxidase antibodies were from Jackson ImmunoResearch USA. Anti-mouse/rabbit immunoglobulin conjugated Alexa Fluor 488 and Alexa Fluor 647 were from Molecular Probes, ThermoFischer Scientific. TAK1 dominant negative construct was a kind gift from Prof. K.N Balaji (MCBL, Indian Institute of Science) which was obtained from Dr. Jun Nonomiya-Tsuji (North Carolina State University, Raleigh, NC).

Pant I., Rao S.G, & Kondaiah P. (2016). Role of areca nut induced JNK/ATF2/Jun axis in the activation of TGF-β pathway in precancerous Oral Submucous Fibrosis. Scientific Reports, 6, 34314.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!