Cells or tissues were added with 50 μL radio-immunoprecipitation assay (RIPA) lysis buffer (containing protease inhibitor) (P0013J, Beyotime, Shanghai, China) and protein was gained and quantified by utilization of the bicinchoninic acid (BCA) kit (PC0020, Solarbio). Later, 50 μg of protein was subjected to electrophoresis, and then transferred to nitrocellulose membranes (66485, Pall Corp, East Hills, NY). The membrane was sealed in 5% skimmed milk powder at ambient temperature for 2 h and probed with primary antibodies against KIF3A (ab11259, 1:2000, Abcam), p21 (ab109520, 1:1000, Abcam), p-p21 (ab47300, 1:1000, Abcam), Bax (ab32503, 1:1000, Abcam), Bcl-2 (#4223, 1:1000, Cell Signaling Technology [CST]), Cle-caspase 3 (ab32042, 1:500, Abcam), CD63 (ab134045, 1:1000, Abcam), CD81 (#56039, 1:1000, CST), Hsp70 (#4876, 1:1000, CST), Calreticulin (ab92516, 1:1000, Abcam) and β-actin (#4970, 1:1000, CST) overnight at 4 °C. The next day, the membrane was further incubated with horseradish peroxidase (HRP)-labeled secondary antibody goat anti-rabbit IgG (ab6721, 1:2000, Abcam) at ambient temperature for 1 h. Afterwards, the membrane was visualized by ECL reagent (BM101, Biomiga Inc), and then BioSpectrum 600 imaging system (Ultra-Violet Products, UK) was processed for detection and analysis. β-actin was used as normalizer.
Ab11259
Manufactured by Abcam
Sourced in United Kingdom
Ab11259 is a monoclonal antibody that recognizes human CD4. It is suitable for use in immunohistochemistry, flow cytometry, and related applications.
Automatically generated - may contain errors
Lab products found in correlation
Nitrocellulose membrane, by Pall Corporation (1 mentions)
Bca kit, by Solarbio (1 mentions)
Ab32042, by Abcam (1 mentions)
Ab6721, by Abcam (1 mentions)
Ab32503, by Abcam (1 mentions)
Ab47300, by Abcam (1 mentions)
Ab134045, by Abcam (1 mentions)
Ab92516, by Abcam (1 mentions)
Ab109520, by Abcam (1 mentions)
Sc 271786, by Santa Cruz Biotechnology (1 mentions)
Ab34710, by Abcam (1 mentions)
Ab125356, by Abcam (1 mentions)
A12598, by ABclonal (1 mentions)
A3274, by ABclonal (1 mentions)
Af6160, by Affinity Biosciences (1 mentions)
Af5202, by Affinity Biosciences (1 mentions)
Af7010, by Affinity Biosciences (1 mentions)
Sc 23950, by Santa Cruz Biotechnology (1 mentions)
Sc 25778, by Santa Cruz Biotechnology (1 mentions)
Lamin b, by Santa Cruz Biotechnology (1 mentions)
5 protocols using ab11259
1
Western Blot Analysis of Protein Expression
2
Comprehensive Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blot was performed as previously described 20 (link). Primary antibody used in our studies included Ac-α-Tub, collagen type I (COL I), KIF3A (ab125356, ab34710, ab11259, Abcam), intraflagellar transport protein (IFT) 88 (MFG42775, Aviva Systems Biology), ARL13B (GTX122703, GeneTex), α-SMA, (1184-1, Eptomics), MRTF-A, SHH, SMO, GLI1 (A12598, A7726, A3274, and A8387, ABclonal, Wuhan, China), SRF, PTC1, α-Tub (AF6160, AF5202, AF7010, Affinity Biosciences, Cincinnati, OH, USA), Ac-α-Tub, LaminB, GLI2, GLI3, and GAPDH (sc-23950, sc-56143, sc-271786, sc-74478, and sc-25778, Santa Cruz Biotechnology, Santa Cruz, CA, USA).The results were normalised with loading control and expressed as the fold of the specific bands to the control group. Western blotting was repeated at least three times.
3
Immunofluorescence Staining of Cilia Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were fixed with 4% paraformaldehyde at room temperature or methanol at −20°C for 10 min after quick rinses with phosphate-buffered saline (PBS). The cells were then permeabilized with washing solution (PBS with 0.1% Triton X-100) for 10 min and blocked with 3% bovine serum albumin for 30 min. Primary antibodies (goat IFT88 [1:100] [ab42497; Abcam, Cambridge, UK]; rabbit KIF3A [1:200] [ab11259; Abcam]; and rabbit BBS2 [1:100] [11188-2-AP; Proteintech, Rosemont, IL]) were diluted in the blocking solution. The cells were incubated in the primary antibody solution for 1 h at room temperature; this was followed by three rinses in the washing solution. The cells were then stained with secondary antibodies Alexa Fluor 647 (A21447; Thermo Fisher Scientific) and Cy3B (conjugating Cy3B maleimide; PA63131; GE, Pittsburgh, PA) to immunoglobulin G antibodies (711-005-152; Jackson, West Grove, PA)) for 1 h before being washed five times.
4
Analyzing KIF3A and MMPs in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used the following antibodies in our research: rabbit anti‐KIF3A Ig [1 : 500 dilution for immunohistochemistry (IHC) assays; 1 : 2000 dilution for immunoblot assays, ab11259; Abcam, Cambridge, UK], mice anti‐β‐actin Ig (1 : 2000 dilution, ab8227; Abcam), rabbit anti‐Ki67 Ig (1 : 2000 dilution, ab16667; Abcam), rabbit anti‐matrix metalloproteinase 2 (MMP2) Ig (1 : 1000 dilution, ab37150; Abcam) and rabbit anti‐MMP9 Ig (1 : 2000 dilution, ab38898; Abcam).
Primer sequences of quantitative PCR (qPCR) were designed as follows: KIF3A_F: 5′‐ATAGTTCCCGTTCCCATG‐3′, KIF3A_R: 5′‐CTGACCCACTGA TATCAGAG‐3′; GAPDH_F (glyceraldehyde‐3 phosphate dehydrogenase forward): 5′‐CGACCACTTTGTCAAGCTCA‐3′, GAPDH_R: 5′‐GGTTGAGCACAGGGTACTTTATT‐3′. shRNA plasmids [ready‐to‐package adenoassociated virus (AAV)] of KIF3A were purchased from Addgene (Cambridge, MA, USA).
Primer sequences of quantitative PCR (qPCR) were designed as follows: KIF3A_F: 5′‐ATAGTTCCCGTTCCCATG‐3′, KIF3A_R: 5′‐CTGACCCACTGA TATCAGAG‐3′; GAPDH_F (glyceraldehyde‐3 phosphate dehydrogenase forward): 5′‐CGACCACTTTGTCAAGCTCA‐3′, GAPDH_R: 5′‐GGTTGAGCACAGGGTACTTTATT‐3′. shRNA plasmids [ready‐to‐package adenoassociated virus (AAV)] of KIF3A were purchased from Addgene (Cambridge, MA, USA).
5
Investigating Hedgehog Signaling Pathway Inhibitors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GANT61 (G9048), cyclopamine, protease inhibitor cocktail, and Lubrol-PX were purchased from Sigma-Aldrich (St. Louis, MO, USA). DMSO was purchased from Amresco and was used as the solvent for some reagents and the vehicle control. Puromycin was purchased from Salarbio. Doxycycline was purchased from Sangon Biotech (Shanghai, China). The primary antibody against Gli1 (2643S) was purchased from Cell Signaling (CST); the primary antibody against Kif3a (ab11259) were purchased from Abcam. The primary antibody against MMP-7 (C0273) was purchased from ANBO; antibody against Gli2 (sc28674) was purchased from Santa Cruz; antibody against GAPDH (MAB374) was purchased from Millipore. Enhanced chemiluminescence (ECL) Western blot detection reagents were purchased from Thermo Fisher Scientific Inc. The BLOCK-iT Pol II miR RNAi Expression Vector Kit (K4936-00) and Lipofectamine 2000 (11668-019) were purchased from Invitrogen.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!