Pcr primers

Total RNA was extracted from the mouse gastrocnemius muscles and the liver using isogen (Wako Pure Chemical Industries Ltd.), according to the manufacturer's instructions. Reverse transcription (RT) polymerase chain reaction (PCR) was performed using total RNA samples obtained from the gastrocnemius and the liver using an ABI 7300 system (Applied Biosystems). Real‐time PCR using the DNA‐binding dye SYBR Green was used for detection of the PCR products for RNA sample obtained from cells after synthesized cDNA. The following PCR primers (Sigma‐Aldrich Japan K.K., Hokkaido, Japan) were used: FGF21, 5′‐CAGGGAGGATGGAACAGTGGTA‐3′ (forward) and 5′‐TGACACCCAGGATTTGAATGAC‐3′(reverse); β‐actin, 5′‐TATCCACCTTCCAGCAGATG‐3′ (forward) and 5′‐AGCTCAGTAACAGTCCGCCTA‐3′ (reverse). The respective ratios of the other signals to that of β‐actin were calculated for all samples. Normalized values were expressed as a relative value using the value of the RUN group as 1.

Phosphate-buffered saline (PBS), 4-aminobenzoic acid, N-hydroxysuccinimide (NHS), 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), and PCR primers were purchased from Sigma-Aldrich (Germany). Potassium hexacyanoferrate (III), hexaammineruthenium (III), sodium nitrite, hydrochloric acid, and dipotassium phosphate monopotassium phosphate were purchased from ChemPur (Poland). An ExtractMe DNA Bacteria kit was purchased from Blirt (Poland), and a SensiFAST SYBR No-ROX kit was purchased from Bioline (UK). Phosphate buffer with different pH (5.68, 7.01, 7.99) was prepared by mixing the K₂HPO₄ and KH₂PO₄ in different ratios. All reagents were used without further purification. Aqueous solutions were prepared with the usage of double-distilled sterile water (ddH₂O).
All biomaterials utilised in this manuscript are accurately described elsewhere [30 (link)]. Herein, we present them briefly. The monoclonal mouse antibodies were produced by the Nanobioengineering Laboratory at the Polish Center for Technology Development Ltd. through procedures described elsewhere [31 ], with slight changes. Recombinant protein D was isolated at the Institute of Biotechnology and Molecular Medicine following the standard procedures. The efficiency and quality of antibody production were verified with the ELISA test (data are not shown).

All reagents were purchased from Wako (Osaka, Japan) unless otherwise noted. All PCR primers were purchased from Sigma-Aldrich (Tokyo, Japan) or Eurofins Genomics (Tokyo, Japan).

Genotyping was performed with two sets of PCR primers (Sigma Aldrich, Gillingham, UK). The first amplified a region of AhR exon 2 present in the wild type but not the knockout mice, that is, forward TTCAGAGTAAAGCCCATCCC and reverse ATCAAAGAAGCTCTTGGCCC. The second set amplified a region of the neomycin gene only present in the knockout animals, that is, forward TGGGTGGAGAGGCTATTC and reverse ATGGTGAGATGACAGGAGATC (http://blast.ncbi.nlm.nih.gov/). Mice were genotyped prior to experimentation using DNA derived from ear clip tissue.